Incidental Mutation 'R4131:Prelid2'
ID314689
Institutional Source Beutler Lab
Gene Symbol Prelid2
Ensembl Gene ENSMUSG00000056671
Gene NamePRELI domain containing 2
SynonymsC330008K14Rik, 1700003A01Rik
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location41875696-41951194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41951159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 6 (D6A)
Ref Sequence ENSEMBL: ENSMUSP00000064661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070949
AA Change: D6A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064661
Gene: ENSMUSG00000056671
AA Change: D6A

DomainStartEndE-ValueType
Pfam:PRELI 16 173 2.8e-51 PFAM
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Prelid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Prelid2 APN 18 41912423 missense probably damaging 1.00
IGL01731:Prelid2 APN 18 41937649 missense probably benign 0.03
R0217:Prelid2 UTSW 18 41935252 splice site probably benign
R0556:Prelid2 UTSW 18 41951180 start gained probably benign
R0627:Prelid2 UTSW 18 41937652 missense possibly damaging 0.50
R0848:Prelid2 UTSW 18 41935224 missense probably damaging 0.98
R1522:Prelid2 UTSW 18 41881267 missense probably benign
R3919:Prelid2 UTSW 18 41937675 missense possibly damaging 0.79
R4422:Prelid2 UTSW 18 41912396 missense probably benign 0.01
R4892:Prelid2 UTSW 18 41951144 missense possibly damaging 0.86
R6062:Prelid2 UTSW 18 41912465 missense probably benign 0.00
R6725:Prelid2 UTSW 18 41912449 missense possibly damaging 0.82
R7276:Prelid2 UTSW 18 41912422 missense possibly damaging 0.65
R7739:Prelid2 UTSW 18 41912368 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTCGAGGAAAACCGCCTC -3'
(R):5'- TGGTGAGCGCTTTATAGGAC -3'

Sequencing Primer
(F):5'- TGCACATCCCGGGAGCAG -3'
(R):5'- CGTAAGTGAAAGGGGATGTGG -3'
Posted On2015-05-14