Incidental Mutation 'R4132:Cmklr1'
ID314701
Institutional Source Beutler Lab
Gene Symbol Cmklr1
Ensembl Gene ENSMUSG00000042190
Gene Namechemokine-like receptor 1
SynonymsChemR23, Gpcr27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4132 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location113612354-113650426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113614484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 152 (R152L)
Ref Sequence ENSEMBL: ENSMUSP00000121765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047936] [ENSMUST00000132065] [ENSMUST00000142854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047936
AA Change: R152L

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036316
Gene: ENSMUSG00000042190
AA Change: R152L

DomainStartEndE-ValueType
Pfam:7tm_1 55 314 2.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132065
AA Change: R152L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121765
Gene: ENSMUSG00000042190
AA Change: R152L

DomainStartEndE-ValueType
Pfam:7tm_1 55 301 5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142854
Meta Mutation Damage Score 0.4712 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have defects in immunomodulation of monocyte and neutriphils by chemerin [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 T C 1: 92,885,100 M496V probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Gm1527 A T 3: 28,920,630 I531L probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Icam5 T C 9: 21,036,657 I617T probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhdc4 C T 8: 121,798,065 G375R possibly damaging Het
Myo5c G A 9: 75,252,568 V293I probably benign Het
Ncbp1 C T 4: 46,169,241 R672* probably null Het
Pcdhga2 T C 18: 37,670,054 I317T possibly damaging Het
Safb C A 17: 56,600,848 probably benign Het
Tspan5 C T 3: 138,896,867 R106* probably null Het
Ubap2l A G 3: 90,009,184 Y908H probably damaging Het
Uspl1 A G 5: 149,204,349 N372S probably damaging Het
Vmn1r210 T C 13: 22,827,649 I156V probably benign Het
Zbtb8os A G 4: 129,336,113 Y24C probably damaging Het
Other mutations in Cmklr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Cmklr1 APN 5 113614221 missense probably benign 0.04
IGL02246:Cmklr1 APN 5 113614400 missense probably benign 0.00
IGL02997:Cmklr1 APN 5 113614640 missense probably benign 0.15
R0098:Cmklr1 UTSW 5 113614470 missense probably benign 0.00
R0360:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R0364:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R1217:Cmklr1 UTSW 5 113614046 missense probably damaging 1.00
R1702:Cmklr1 UTSW 5 113613842 missense probably benign 0.20
R1862:Cmklr1 UTSW 5 113614407 missense probably damaging 0.96
R4131:Cmklr1 UTSW 5 113614484 missense probably damaging 0.97
R4611:Cmklr1 UTSW 5 113614869 missense probably benign 0.05
R4647:Cmklr1 UTSW 5 113614640 missense probably damaging 1.00
R5217:Cmklr1 UTSW 5 113614649 missense probably damaging 0.98
R5484:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5486:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5487:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5504:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5505:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R6301:Cmklr1 UTSW 5 113614938 start codon destroyed possibly damaging 0.72
R6994:Cmklr1 UTSW 5 113614922 missense probably damaging 1.00
R7342:Cmklr1 UTSW 5 113614293 missense probably benign 0.00
Z1176:Cmklr1 UTSW 5 113613891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAAACTACTTGCGAGTGG -3'
(R):5'- TTTGTCAACCTGGCTGTGGC -3'

Sequencing Primer
(F):5'- ACTTGCGAGTGGGCGGG -3'
(R):5'- GATGCACATCACCTACGCGG -3'
Posted On2015-05-14