Incidental Mutation 'R4132:Klhdc4'
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4132 (G1)
Quality Score225
Status Not validated
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121798065 bp
Amino Acid Change Glycine to Arginine at position 375 (G375R)
Ref Sequence ENSEMBL: ENSMUSP00000134361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000167439] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably benign
Transcript: ENSMUST00000045884
AA Change: G406R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: G406R

low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167439
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318

MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172954
Predicted Effect probably benign
Transcript: ENSMUST00000174192
AA Change: G349R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: G349R

Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174206
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect possibly damaging
Transcript: ENSMUST00000174717
AA Change: G375R

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: G375R

low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 T C 1: 92,885,100 M496V probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Gm1527 A T 3: 28,920,630 I531L probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Icam5 T C 9: 21,036,657 I617T probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Myo5c G A 9: 75,252,568 V293I probably benign Het
Ncbp1 C T 4: 46,169,241 R672* probably null Het
Pcdhga2 T C 18: 37,670,054 I317T possibly damaging Het
Safb C A 17: 56,600,848 probably benign Het
Tspan5 C T 3: 138,896,867 R106* probably null Het
Ubap2l A G 3: 90,009,184 Y908H probably damaging Het
Uspl1 A G 5: 149,204,349 N372S probably damaging Het
Vmn1r210 T C 13: 22,827,649 I156V probably benign Het
Zbtb8os A G 4: 129,336,113 Y24C probably damaging Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
R7716:Klhdc4 UTSW 8 121829420 missense unknown
R8430:Klhdc4 UTSW 8 121799513 missense possibly damaging 0.82
R8841:Klhdc4 UTSW 8 121796641 missense possibly damaging 0.84
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14