Mutagenetix > Incidental Mutations

Incidental Mutation 'R4133:Arhgef4'

314716

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

041637-MU

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34806104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1463 (D1463G)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000211073]

AlphaFold

Q7TNR9

Predicted Effect

probably damaging
Transcript: ENSMUST00000047664
AA Change: D92G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: D92G

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
RhoGEF	82	261	3.86e-56	SMART
PH	294	402	2.33e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159021
AA Change: D175G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509
AA Change: D175G

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	190	3.4e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159059

Predicted Effect

probably damaging
Transcript: ENSMUST00000159747
AA Change: D1463G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: D1463G

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160855
AA Change: D92G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509
AA Change: D92G

Domain	Start	End	E-Value	Type
SH3	1	45	6.97e-7	SMART
Pfam:RhoGEF	82	187	1.2e-21	PFAM
low complexity region	194	211	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162599
AA Change: D296G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: D296G

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
SH3	194	249	3.73e-16	SMART
Pfam:RhoGEF	304	405	1.2e-25	PFAM
PH	438	546	2.33e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193040

Predicted Effect

probably benign
Transcript: ENSMUST00000211073

Meta Mutation Damage Score

0.1737

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgap42	C	T	9: 9,011,299		probably benign	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Ddx60	A	G	8: 61,972,220	K681E	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Dnah7c	G	T	1: 46,665,990	A2388S	probably benign	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Ints9	A	G	14: 64,990,554	H103R	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Ptpro	G	T	6: 137,420,372	W81C	probably damaging	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCTTCAGATGACCTAGAGCGG -3'
(R):5'- GTGTACCCCACTATATGCCACG -3'

Sequencing Primer
(F):5'- CTTCAGATGACCTAGAGCGGAGTTC -3'
(R):5'- ATATGCCACGCCCTCCG -3'

Posted On

2015-05-14