Mutagenetix > Incidental Mutation

Incidental Mutation 'R4133:Dnah7c'

314718

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

041637-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 46665990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 2388 (A2388S)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000189749
AA Change: A2388S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: A2388S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Meta Mutation Damage Score

0.1356

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgap42	C	T	9: 9,011,299		probably benign	Het
Arhgef4	A	G	1: 34,806,104	D1463G	probably damaging	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Ddx60	A	G	8: 61,972,220	K681E	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Ints9	A	G	14: 64,990,554	H103R	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Ptpro	G	T	6: 137,420,372	W81C	probably damaging	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AATCTTGAAGCAGCCACGGAG -3'
(R):5'- GCAGCGGTCAATAAACATGTTG -3'

Sequencing Primer
(F):5'- GAGCCACGCCCTCCTGG -3'
(R):5'- CATGTTGAAAAGAGCTATGGGGC -3'

Posted On

2015-05-14