Incidental Mutation 'R4133:Dnah7c'
ID 314718
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission 041637-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R4133 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 46464752-46846636 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46705150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 2388 (A2388S)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: A2388S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: A2388S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,677,280 (GRCm39) noncoding transcript Het
Aldh3b1 A G 19: 3,970,808 (GRCm39) I184T probably damaging Het
Arhgap42 C T 9: 9,011,300 (GRCm39) probably benign Het
Arhgef4 A G 1: 34,845,185 (GRCm39) D1463G probably damaging Het
Arpc5 A G 1: 152,644,622 (GRCm39) T52A probably benign Het
Asb6 A G 2: 30,718,247 (GRCm39) probably benign Het
Ash1l T C 3: 88,889,567 (GRCm39) V482A probably benign Het
Bop1 T C 15: 76,338,535 (GRCm39) N469S probably benign Het
Btaf1 T A 19: 36,939,138 (GRCm39) N266K probably benign Het
Btla T C 16: 45,059,661 (GRCm39) Y122H probably damaging Het
Cacna1g A G 11: 94,323,370 (GRCm39) M1278T probably damaging Het
Cdc42bpb A G 12: 111,287,976 (GRCm39) S524P probably benign Het
Cep78 A G 19: 15,946,519 (GRCm39) S438P probably damaging Het
Clca4a T G 3: 144,675,113 (GRCm39) E171D probably benign Het
Cldn6 A T 17: 23,900,467 (GRCm39) I144F probably damaging Het
Cpd G A 11: 76,705,644 (GRCm39) Q363* probably null Het
Cpn1 G A 19: 43,974,723 (GRCm39) P2L possibly damaging Het
Ddx31 A G 2: 28,748,864 (GRCm39) D264G probably damaging Het
Ddx39b C T 17: 35,472,065 (GRCm39) S368L probably damaging Het
Ddx60 A G 8: 62,425,254 (GRCm39) K681E probably damaging Het
Dennd1c A C 17: 57,383,980 (GRCm39) W15G possibly damaging Het
Dgkd T G 1: 87,869,223 (GRCm39) probably null Het
Etv4 C A 11: 101,661,324 (GRCm39) K442N probably damaging Het
Fam234a T C 17: 26,432,532 (GRCm39) D539G probably damaging Het
Fancm A G 12: 65,167,304 (GRCm39) T1538A probably benign Het
Fbn2 A T 18: 58,229,034 (GRCm39) N725K possibly damaging Het
Fcer2a T A 8: 3,741,130 (GRCm39) N4I possibly damaging Het
Fgd5 T C 6: 92,046,418 (GRCm39) V1229A probably damaging Het
Garin4 A T 1: 190,895,205 (GRCm39) N479K probably benign Het
Gm5471 A T 15: 44,835,297 (GRCm39) noncoding transcript Het
Gm5478 T A 15: 101,553,080 (GRCm39) I331F probably damaging Het
Gm6729 C A 10: 86,377,030 (GRCm39) noncoding transcript Het
Hectd4 G T 5: 121,415,897 (GRCm39) probably null Het
Hspb3 A C 13: 113,800,027 (GRCm39) M1R probably null Het
Igkv10-95 T C 6: 68,657,601 (GRCm39) V19A probably damaging Het
Il1rap A G 16: 26,541,636 (GRCm39) S626G probably benign Het
Ints9 A G 14: 65,228,003 (GRCm39) H103R probably benign Het
Itga4 T A 2: 79,152,996 (GRCm39) D894E probably damaging Het
Khsrp T C 17: 57,332,605 (GRCm39) H225R probably benign Het
Lama1 T C 17: 68,057,650 (GRCm39) Y575H probably damaging Het
Lama1 A T 17: 68,119,481 (GRCm39) I2653F probably damaging Het
Map4k5 A T 12: 69,892,497 (GRCm39) L144Q probably damaging Het
Mcm5 A G 8: 75,842,482 (GRCm39) Y252C probably damaging Het
Mmgt2 A G 11: 62,555,877 (GRCm39) E75G probably damaging Het
Mroh2a A T 1: 88,182,687 (GRCm39) N1205I possibly damaging Het
Nckap5 A G 1: 126,150,443 (GRCm39) V162A probably benign Het
Nr3c2 T C 8: 77,636,378 (GRCm39) I493T probably damaging Het
Or2ag16 A C 7: 106,352,286 (GRCm39) L103R probably damaging Het
Or2t46 A T 11: 58,471,901 (GRCm39) Y77F probably damaging Het
Or9s15 T C 1: 92,524,465 (GRCm39) F75L probably benign Het
Papola A G 12: 105,765,917 (GRCm39) T6A possibly damaging Het
Ppp1cc G A 5: 122,306,289 (GRCm39) R36Q probably benign Het
Ptpro G T 6: 137,397,370 (GRCm39) W81C probably damaging Het
Rasgrf2 A G 13: 92,130,773 (GRCm39) S162P possibly damaging Het
Rpusd2 T C 2: 118,869,196 (GRCm39) S540P probably damaging Het
Scn5a T A 9: 119,315,438 (GRCm39) T1757S probably damaging Het
Setbp1 T C 18: 78,900,206 (GRCm39) I1154V probably benign Het
Sirt1 T C 10: 63,171,438 (GRCm39) I209V probably null Het
Slco6c1 T A 1: 97,009,218 (GRCm39) I406L probably benign Het
Smc2 A G 4: 52,450,947 (GRCm39) E255G probably damaging Het
Snap91 C A 9: 86,659,102 (GRCm39) G477V probably damaging Het
Speg A G 1: 75,404,548 (GRCm39) Q2780R probably benign Het
Spmap2 T C 10: 79,415,884 (GRCm39) T236A probably damaging Het
Ssh2 A G 11: 77,312,095 (GRCm39) Y196C probably damaging Het
Ssxb9 A T X: 8,235,845 (GRCm39) T18S probably damaging Het
Stxbp5l T C 16: 37,028,481 (GRCm39) I527M possibly damaging Het
Tex10 T C 4: 48,468,968 (GRCm39) Y69C probably damaging Het
Thoc3 T C 13: 54,616,361 (GRCm39) D87G probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trps1 T C 15: 50,694,783 (GRCm39) K213R probably damaging Het
Uggt1 A T 1: 36,197,240 (GRCm39) L1221Q probably damaging Het
Vmn2r3 T A 3: 64,183,138 (GRCm39) Y187F probably damaging Het
Washc2 G A 6: 116,235,891 (GRCm39) E1121K probably damaging Het
Zfx T C X: 93,124,464 (GRCm39) N360D probably damaging Het
Znhit3 A G 11: 84,807,139 (GRCm39) V10A probably benign Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46,846,449 (GRCm39) missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46,696,271 (GRCm39) missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46,563,277 (GRCm39) missense probably benign 0.37
IGL03161:Dnah7c APN 1 46,506,456 (GRCm39) missense probably benign 0.20
IGL03178:Dnah7c APN 1 46,506,525 (GRCm39) missense probably benign
IGL03052:Dnah7c UTSW 1 46,671,309 (GRCm39) missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46,505,065 (GRCm39) missense probably benign
R1029:Dnah7c UTSW 1 46,651,881 (GRCm39) missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46,837,439 (GRCm39) missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46,668,071 (GRCm39) missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46,720,977 (GRCm39) missense probably damaging 1.00
R4303:Dnah7c UTSW 1 46,787,738 (GRCm39) missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46,688,441 (GRCm39) missense probably benign 0.33
R4434:Dnah7c UTSW 1 46,705,442 (GRCm39) missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46,779,781 (GRCm39) missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46,787,795 (GRCm39) missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46,805,771 (GRCm39) missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46,572,091 (GRCm39) missense probably benign 0.34
R4571:Dnah7c UTSW 1 46,572,376 (GRCm39) missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46,553,743 (GRCm39) nonsense probably null
R4731:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46,809,333 (GRCm39) missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46,572,328 (GRCm39) missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46,832,692 (GRCm39) missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46,728,085 (GRCm39) missense probably benign
R4875:Dnah7c UTSW 1 46,728,085 (GRCm39) missense probably benign
R4916:Dnah7c UTSW 1 46,634,168 (GRCm39) missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46,569,660 (GRCm39) missense probably benign
R5279:Dnah7c UTSW 1 46,558,429 (GRCm39) missense probably benign 0.14
R5327:Dnah7c UTSW 1 46,704,728 (GRCm39) missense probably benign 0.05
R5546:Dnah7c UTSW 1 46,705,477 (GRCm39) missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46,837,395 (GRCm39) missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46,799,521 (GRCm39) splice site probably null
R5639:Dnah7c UTSW 1 46,778,828 (GRCm39) missense probably benign
R5663:Dnah7c UTSW 1 46,574,308 (GRCm39) missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46,787,826 (GRCm39) missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46,654,527 (GRCm39) missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46,678,825 (GRCm39) missense probably benign 0.00
R5784:Dnah7c UTSW 1 46,563,228 (GRCm39) missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46,686,175 (GRCm39) missense probably benign 0.01
R5933:Dnah7c UTSW 1 46,558,375 (GRCm39) missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46,711,657 (GRCm39) missense probably benign 0.21
R6034:Dnah7c UTSW 1 46,496,418 (GRCm39) missense probably benign 0.00
R6034:Dnah7c UTSW 1 46,496,418 (GRCm39) missense probably benign 0.00
R6487:Dnah7c UTSW 1 46,808,284 (GRCm39) missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46,697,450 (GRCm39) missense probably benign 0.00
R6614:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6614:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6615:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6615:Dnah7c UTSW 1 46,554,599 (GRCm39) missense probably benign 0.01
R6615:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6649:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6649:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6650:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6650:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6651:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6651:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6653:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6653:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6714:Dnah7c UTSW 1 46,779,966 (GRCm39) missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46,711,681 (GRCm39) missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46,688,511 (GRCm39) missense probably benign
R6760:Dnah7c UTSW 1 46,688,500 (GRCm39) missense probably benign
R6763:Dnah7c UTSW 1 46,668,050 (GRCm39) missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46,696,403 (GRCm39) missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46,566,831 (GRCm39) missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46,705,373 (GRCm39) missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46,494,973 (GRCm39) missense probably benign 0.07
R7007:Dnah7c UTSW 1 46,571,910 (GRCm39) missense probably benign 0.04
R7086:Dnah7c UTSW 1 46,789,285 (GRCm39) missense probably benign 0.00
R7128:Dnah7c UTSW 1 46,566,645 (GRCm39) missense probably benign
R7131:Dnah7c UTSW 1 46,720,932 (GRCm39) missense probably benign 0.00
R7135:Dnah7c UTSW 1 46,572,368 (GRCm39) missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46,719,898 (GRCm39) missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46,469,969 (GRCm39) missense probably benign 0.00
R7221:Dnah7c UTSW 1 46,494,937 (GRCm39) missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46,636,127 (GRCm39) missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46,819,935 (GRCm39) missense probably benign 0.31
R7319:Dnah7c UTSW 1 46,823,608 (GRCm39) missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46,705,223 (GRCm39) missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46,686,196 (GRCm39) missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46,496,450 (GRCm39) missense probably benign
R7534:Dnah7c UTSW 1 46,809,227 (GRCm39) missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46,823,658 (GRCm39) missense probably benign 0.00
R7605:Dnah7c UTSW 1 46,671,470 (GRCm39) missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46,641,973 (GRCm39) missense probably benign
R7770:Dnah7c UTSW 1 46,665,460 (GRCm39) splice site probably null
R7884:Dnah7c UTSW 1 46,830,929 (GRCm39) missense probably benign 0.23
R7899:Dnah7c UTSW 1 46,553,861 (GRCm39) missense probably benign 0.00
R8025:Dnah7c UTSW 1 46,496,456 (GRCm39) missense probably benign 0.01
R8057:Dnah7c UTSW 1 46,728,112 (GRCm39) missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46,646,618 (GRCm39) missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46,698,589 (GRCm39) missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46,711,536 (GRCm39) missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46,572,398 (GRCm39) missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46,719,952 (GRCm39) missense probably benign 0.05
R8559:Dnah7c UTSW 1 46,764,299 (GRCm39) missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46,711,701 (GRCm39) missense probably benign 0.00
R8869:Dnah7c UTSW 1 46,671,504 (GRCm39) missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46,805,816 (GRCm39) missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46,816,896 (GRCm39) missense probably benign 0.00
R9121:Dnah7c UTSW 1 46,704,650 (GRCm39) missense probably damaging 0.97
R9246:Dnah7c UTSW 1 46,571,934 (GRCm39) missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46,521,168 (GRCm39) missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46,779,886 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46,654,441 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46,506,462 (GRCm39) missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46,799,476 (GRCm39) missense possibly damaging 0.95
Z1176:Dnah7c UTSW 1 46,686,152 (GRCm39) critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46,678,825 (GRCm39) missense probably benign
Z1177:Dnah7c UTSW 1 46,693,263 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATCTTGAAGCAGCCACGGAG -3'
(R):5'- GCAGCGGTCAATAAACATGTTG -3'

Sequencing Primer
(F):5'- GAGCCACGCCCTCCTGG -3'
(R):5'- CATGTTGAAAAGAGCTATGGGGC -3'
Posted On 2015-05-14