Incidental Mutation 'R4133:Dgkd'
ID314721
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 87941501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332] [ENSMUST00000189448] [ENSMUST00000190061]
Predicted Effect probably null
Transcript: ENSMUST00000027517
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040783
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185260
Predicted Effect probably benign
Transcript: ENSMUST00000187758
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 70 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189409
Predicted Effect probably benign
Transcript: ENSMUST00000189448
SMART Domains Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189726
Predicted Effect probably benign
Transcript: ENSMUST00000190061
SMART Domains Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
DAGKa 1 95 7.6e-26 SMART
Blast:DAGKa 119 188 1e-23 BLAST
low complexity region 301 312 N/A INTRINSIC
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Z1176:Dgkd UTSW 1 87927810 missense probably benign 0.05
Z1177:Dgkd UTSW 1 87916886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCTATGGGCATTCACTG -3'
(R):5'- CCCCTAGTTTCTAAGGTTAGGACAG -3'

Sequencing Primer
(F):5'- GTCTCTGACAGTTCACCTC -3'
(R):5'- GTGGCTAAGAAAATCAAGGCTTCTCC -3'
Posted On2015-05-14