Incidental Mutation 'R4133:Fcer2a'
ID314744
Institutional Source Beutler Lab
Gene Symbol Fcer2a
Ensembl Gene ENSMUSG00000005540
Gene NameFc receptor, IgE, low affinity II, alpha polypeptide
SynonymsLy-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3681737-3694175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3691130 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 4 (N4I)
Ref Sequence ENSEMBL: ENSMUSP00000005678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]
PDB Structure
[]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005678
AA Change: N4I

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540
AA Change: N4I

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207327
Predicted Effect probably benign
Transcript: ENSMUST00000207463
AA Change: N4I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect unknown
Transcript: ENSMUST00000207635
AA Change: N4I
Predicted Effect probably benign
Transcript: ENSMUST00000208145
Predicted Effect probably benign
Transcript: ENSMUST00000208438
Predicted Effect probably benign
Transcript: ENSMUST00000208492
Predicted Effect probably benign
Transcript: ENSMUST00000208603
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Fcer2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.94
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.45
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.94
IGL03340:Fcer2a APN 8 3688310 missense possibly damaging 0.75
anemone UTSW 8 3688796 critical splice donor site probably null
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense possibly damaging 0.89
R1530:Fcer2a UTSW 8 3682976 missense probably damaging 0.98
R2202:Fcer2a UTSW 8 3688557 missense possibly damaging 0.72
R4249:Fcer2a UTSW 8 3688831 missense probably benign 0.00
R4273:Fcer2a UTSW 8 3682848 missense possibly damaging 0.81
R4506:Fcer2a UTSW 8 3688603 splice site probably null
R6796:Fcer2a UTSW 8 3689830 missense possibly damaging 0.92
R6861:Fcer2a UTSW 8 3682910 missense probably damaging 0.98
R7421:Fcer2a UTSW 8 3690335 missense probably benign
R7795:Fcer2a UTSW 8 3682910 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGGAAGGTGTTGAGTCACAG -3'
(R):5'- GGCTTCCAGAACCTTCAAGTC -3'

Sequencing Primer
(F):5'- GAGGGGCCTTGAATTTCCC -3'
(R):5'- GAACCTTCAAGTCCCAGATGCTG -3'
Posted On2015-05-14