Mutagenetix > Incidental Mutation

Incidental Mutation 'R4133:Ddx60'

314745

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

041637-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61972220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 681 (K681E)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000070631
AA Change: K680E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: K680E

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000093485
AA Change: K681E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: K681E

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Meta Mutation Damage Score

0.1456

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgap42	C	T	9: 9,011,299		probably benign	Het
Arhgef4	A	G	1: 34,806,104	D1463G	probably damaging	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Dnah7c	G	T	1: 46,665,990	A2388S	probably benign	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Ints9	A	G	14: 64,990,554	H103R	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Ptpro	G	T	6: 137,420,372	W81C	probably damaging	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGGTGAGTAAGAGAGTAAGTGTCATG -3'
(R):5'- GTGCAAACACAGCTCTTTTAGAATT -3'

Sequencing Primer
(F):5'- TAAGCTAGGTGGTTGAGC -3'
(R):5'- TCCCCAAGAGAAGGTTGGTC -3'

Posted On

2015-05-14