Mutagenetix > Incidental Mutation

Incidental Mutation 'R4133:Arhgap42'

314747

Institutional Source

Beutler Lab

Gene Symbol

Arhgap42

Ensembl Gene

ENSMUSG00000050730

Gene Name

Rho GTPase activating protein 42

Synonyms

9030420J04Rik

MMRRC Submission

041637-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8994329-9239101 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 9011299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093893]

AlphaFold

B2RQE8

Predicted Effect

probably benign
Transcript: ENSMUST00000093893

SMART Domains

Protein: ENSMUSP00000091419
Gene: ENSMUSG00000050730

Domain	Start	End	E-Value	Type
Pfam:BAR_3	6	132	4.4e-36	PFAM
Pfam:BAR_3	125	215	8.9e-29	PFAM
PH	232	342	5.5e-8	SMART
RhoGAP	358	535	1.4e-55	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	599	616	N/A	INTRINSIC
Blast:RhoGAP	617	691	2e-37	BLAST
low complexity region	692	711	N/A	INTRINSIC
SH3	786	840	7.4e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182617

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit hypertension and increased vascular smooth muscle contractility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgef4	A	G	1: 34,806,104	D1463G	probably damaging	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Ddx60	A	G	8: 61,972,220	K681E	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Dnah7c	G	T	1: 46,665,990	A2388S	probably benign	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Ints9	A	G	14: 64,990,554	H103R	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Ptpro	G	T	6: 137,420,372	W81C	probably damaging	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Arhgap42

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Arhgap42	APN	9	9006343	missense	probably damaging	1.00
IGL00576:Arhgap42	APN	9	8997620	nonsense	probably null
IGL01693:Arhgap42	APN	9	9006506	missense	probably damaging	1.00
IGL01724:Arhgap42	APN	9	8998253	splice site	probably benign
IGL02142:Arhgap42	APN	9	9155359	missense	probably damaging	1.00
IGL02378:Arhgap42	APN	9	9035583	missense	possibly damaging	0.94
IGL02932:Arhgap42	APN	9	9115708	missense	probably damaging	0.98
IGL02992:Arhgap42	APN	9	8998248	splice site	probably benign
IGL03149:Arhgap42	APN	9	9008084	missense	possibly damaging	0.71
R0096:Arhgap42	UTSW	9	9009313	missense	probably damaging	1.00
R0096:Arhgap42	UTSW	9	9009313	missense	probably damaging	1.00
R0417:Arhgap42	UTSW	9	9180033	missense	possibly damaging	0.55
R0513:Arhgap42	UTSW	9	9005765	missense	probably benign	0.07
R1212:Arhgap42	UTSW	9	9015312	missense	probably damaging	1.00
R1493:Arhgap42	UTSW	9	9030797	missense	probably benign	0.01
R1499:Arhgap42	UTSW	9	9033586	splice site	probably benign
R1674:Arhgap42	UTSW	9	9006584	missense	probably damaging	0.99
R1687:Arhgap42	UTSW	9	9035537	missense	probably benign	0.33
R1808:Arhgap42	UTSW	9	9180050	missense	probably damaging	0.99
R1983:Arhgap42	UTSW	9	9017017	missense	probably damaging	1.00
R2069:Arhgap42	UTSW	9	9035600	missense	probably damaging	1.00
R2276:Arhgap42	UTSW	9	9035511	missense	probably benign
R2279:Arhgap42	UTSW	9	9035511	missense	probably benign
R2295:Arhgap42	UTSW	9	9115744	missense	probably damaging	0.99
R3807:Arhgap42	UTSW	9	9008033	missense	probably damaging	0.98
R4304:Arhgap42	UTSW	9	9006488	missense	probably benign
R4530:Arhgap42	UTSW	9	9011432	missense	probably damaging	1.00
R4532:Arhgap42	UTSW	9	9011432	missense	probably damaging	1.00
R4786:Arhgap42	UTSW	9	9238698	nonsense	probably null
R4807:Arhgap42	UTSW	9	9046628	missense	possibly damaging	0.70
R4809:Arhgap42	UTSW	9	9180117	missense	probably damaging	0.99
R4999:Arhgap42	UTSW	9	9009434	missense	probably damaging	1.00
R5160:Arhgap42	UTSW	9	8997655	missense	probably damaging	0.97
R5737:Arhgap42	UTSW	9	9059068	missense	probably damaging	0.98
R5840:Arhgap42	UTSW	9	9046517	missense	possibly damaging	0.94
R6172:Arhgap42	UTSW	9	9148245	missense	possibly damaging	0.71
R6456:Arhgap42	UTSW	9	9005822	missense	probably benign
R6782:Arhgap42	UTSW	9	9115720	missense	probably damaging	0.99
R6846:Arhgap42	UTSW	9	9006445	missense	probably damaging	1.00
R7489:Arhgap42	UTSW	9	9006358	missense	probably benign
R7560:Arhgap42	UTSW	9	9035531	missense	probably benign	0.00
R8025:Arhgap42	UTSW	9	9005822	missense	probably benign
R8113:Arhgap42	UTSW	9	9011433	missense	probably damaging	1.00
R8303:Arhgap42	UTSW	9	9009326	missense	probably damaging	1.00
R8357:Arhgap42	UTSW	9	9016220	missense	probably benign	0.40
R8457:Arhgap42	UTSW	9	9016220	missense	probably benign	0.40
R9131:Arhgap42	UTSW	9	9011363	missense	probably damaging	1.00
R9132:Arhgap42	UTSW	9	9011418	missense	probably damaging	1.00
R9266:Arhgap42	UTSW	9	9006385	missense	probably benign	0.03
R9570:Arhgap42	UTSW	9	9148208	missense
R9780:Arhgap42	UTSW	9	9059101	missense	probably benign	0.36
X0066:Arhgap42	UTSW	9	9115700	missense	probably damaging	1.00
X0066:Arhgap42	UTSW	9	9115704	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGGAACTTGTTGACCTCAG -3'
(R):5'- ACAGGTTTGACCACAATTACATCTG -3'

Sequencing Primer
(F):5'- GATCACAGTGGACACAATTATCTGC -3'
(R):5'- GTTTGACCACAATTACATCTGTAACC -3'

Posted On

2015-05-14