Incidental Mutation 'R0389:Vmn2r19'
ID 31475
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Name vomeronasal 2, receptor 19
Synonyms EG232358
MMRRC Submission 038595-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0389 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123285292-123313496 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123312945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 672 (I672F)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
AlphaFold G5E8G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000073948
AA Change: I672F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: I672F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,465,053 (GRCm39) E30K unknown Het
Abi3bp A T 16: 56,491,670 (GRCm39) T1319S possibly damaging Het
Adam18 T C 8: 25,119,653 (GRCm39) probably null Het
Adgre1 G A 17: 57,713,839 (GRCm39) D175N possibly damaging Het
Adgrf1 T C 17: 43,614,679 (GRCm39) probably null Het
Ankhd1 A G 18: 36,777,652 (GRCm39) S1612G possibly damaging Het
Anks1 A G 17: 28,214,926 (GRCm39) R458G possibly damaging Het
Cacna1g C T 11: 94,350,523 (GRCm39) V441M probably damaging Het
Cadps2 A T 6: 23,321,781 (GRCm39) V1037E possibly damaging Het
Casz1 T C 4: 149,033,368 (GRCm39) V1380A possibly damaging Het
Cenpq T C 17: 41,244,085 (GRCm39) probably benign Het
Chrac1 T C 15: 72,965,376 (GRCm39) I93T possibly damaging Het
Cntnap2 T A 6: 45,986,571 (GRCm39) S359T probably benign Het
Col6a6 C A 9: 105,661,403 (GRCm39) M235I probably benign Het
Crat T C 2: 30,293,640 (GRCm39) probably benign Het
Cyp1a2 T C 9: 57,589,308 (GRCm39) N169D probably benign Het
Dennd1c T A 17: 57,374,649 (GRCm39) T499S probably benign Het
Dst A G 1: 34,333,631 (GRCm39) probably null Het
Dync2h1 G T 9: 7,167,244 (GRCm39) probably null Het
Eif3h C A 15: 51,662,660 (GRCm39) V129F probably damaging Het
Eno2 A G 6: 124,739,654 (GRCm39) F380L probably damaging Het
Ergic2 T A 6: 148,084,700 (GRCm39) I34F probably benign Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fam185a C T 5: 21,664,283 (GRCm39) T339M probably damaging Het
Fam20b A T 1: 156,509,023 (GRCm39) D396E probably benign Het
Fasn G T 11: 120,707,008 (GRCm39) D881E probably damaging Het
Fat1 C A 8: 45,403,385 (GRCm39) H45Q probably benign Het
Fbxw16 A T 9: 109,261,550 (GRCm39) C439S probably benign Het
Garin1a T A 6: 29,281,391 (GRCm39) V43E possibly damaging Het
Gba2 A T 4: 43,570,832 (GRCm39) F280Y probably damaging Het
Gfm1 A G 3: 67,365,251 (GRCm39) I517V probably benign Het
Gng13 C T 17: 25,937,696 (GRCm39) Q8* probably null Het
Golga1 A T 2: 38,908,453 (GRCm39) S749T probably damaging Het
Gphn A T 12: 78,637,433 (GRCm39) I381F probably damaging Het
Grm3 T C 5: 9,554,794 (GRCm39) N833D probably damaging Het
Gstt2 G T 10: 75,668,266 (GRCm39) T163K probably damaging Het
Gusb A T 5: 130,026,927 (GRCm39) V388E probably damaging Het
Hcrtr2 A T 9: 76,153,662 (GRCm39) Y243* probably null Het
Hspg2 A G 4: 137,242,734 (GRCm39) T650A possibly damaging Het
Ints2 C T 11: 86,139,677 (GRCm39) V306I probably damaging Het
Itga1 T A 13: 115,128,996 (GRCm39) D554V probably benign Het
Itgam C T 7: 127,680,806 (GRCm39) A245V probably damaging Het
Kcnk15 A G 2: 163,700,243 (GRCm39) T161A probably benign Het
Klhl18 A T 9: 110,257,749 (GRCm39) C564S probably benign Het
Krt40 T A 11: 99,432,540 (GRCm39) R159* probably null Het
L3mbtl4 G A 17: 68,762,775 (GRCm39) V103M probably damaging Het
Lnx2 C A 5: 146,955,850 (GRCm39) V649L possibly damaging Het
Lpp A T 16: 24,426,991 (GRCm39) Q39H probably damaging Het
Lrpprc A T 17: 85,060,540 (GRCm39) probably null Het
Map3k19 A T 1: 127,750,152 (GRCm39) N1066K probably benign Het
Mbtps2 G T X: 156,351,364 (GRCm39) T134K probably benign Het
Mfng C T 15: 78,648,637 (GRCm39) V147M possibly damaging Het
Mks1 T C 11: 87,748,754 (GRCm39) S273P probably benign Het
Myh2 T C 11: 67,071,647 (GRCm39) L488P probably damaging Het
Myo15a A G 11: 60,369,364 (GRCm39) N708S probably benign Het
Myo6 A T 9: 80,199,748 (GRCm39) N1019I probably damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Ncoa1 T G 12: 4,345,976 (GRCm39) N457T probably benign Het
Neb T C 2: 52,051,489 (GRCm39) probably null Het
Nlrp4e C A 7: 23,054,628 (GRCm39) N927K probably damaging Het
Npffr2 T C 5: 89,730,613 (GRCm39) M181T probably benign Het
Nxf7 A T X: 134,485,132 (GRCm39) C495S possibly damaging Het
Oas1g T C 5: 121,025,592 (GRCm39) T12A probably benign Het
Or11g2 T A 14: 50,856,036 (GRCm39) L119Q probably damaging Het
Or1e17 T A 11: 73,831,879 (GRCm39) V269E probably benign Het
Or2g7 C G 17: 38,378,562 (GRCm39) R167G possibly damaging Het
Or52s1b A T 7: 102,822,490 (GRCm39) V118E possibly damaging Het
Or5p60 A G 7: 107,724,023 (GRCm39) V149A probably benign Het
Papln C T 12: 83,830,153 (GRCm39) Q1008* probably null Het
Pcdhb10 A C 18: 37,545,485 (GRCm39) D187A probably damaging Het
Phf2 T A 13: 48,957,965 (GRCm39) E1016D unknown Het
Phf8 T A X: 150,335,618 (GRCm39) D197E probably benign Het
Pikfyve A G 1: 65,235,865 (GRCm39) H179R probably damaging Het
Prkcz T A 4: 155,353,597 (GRCm39) D250V probably damaging Het
Prpf4 A G 4: 62,340,842 (GRCm39) Y419C probably damaging Het
Prr15l C A 11: 96,825,440 (GRCm39) Y23* probably null Het
Prr5 T A 15: 84,587,152 (GRCm39) S301T probably benign Het
Psg16 T A 7: 16,829,088 (GRCm39) I224N probably benign Het
Radil A G 5: 142,529,226 (GRCm39) F186L probably damaging Het
Reg3g A T 6: 78,445,544 (GRCm39) M1K probably null Het
Rps6ka3 A G X: 158,100,963 (GRCm39) Y76C probably damaging Het
Rtl1 C T 12: 109,556,797 (GRCm39) V1681I possibly damaging Het
Sfmbt1 C T 14: 30,533,464 (GRCm39) R614C probably damaging Het
Slc12a4 A G 8: 106,678,599 (GRCm39) S244P probably benign Het
Sp140l2 T A 1: 85,247,773 (GRCm39) N5Y probably benign Het
Sptbn1 T C 11: 30,089,250 (GRCm39) T671A possibly damaging Het
Supt16 A T 14: 52,411,570 (GRCm39) N604K probably damaging Het
Synj2 G A 17: 6,080,058 (GRCm39) V1096I probably benign Het
Tas2r129 G T 6: 132,928,159 (GRCm39) C32F probably benign Het
Tbc1d25 T C X: 8,039,108 (GRCm39) Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 (GRCm39) D709G probably benign Het
Tfap2d C T 1: 19,174,591 (GRCm39) R15C possibly damaging Het
Tgfbi C A 13: 56,777,515 (GRCm39) T333N probably benign Het
Tnk1 T C 11: 69,746,508 (GRCm39) Y235C probably damaging Het
Ttc17 A G 2: 94,208,439 (GRCm39) F144S probably benign Het
Twnk G T 19: 44,996,578 (GRCm39) G337V possibly damaging Het
Unc13a A G 8: 72,110,676 (GRCm39) F464L probably benign Het
Usp17le C A 7: 104,417,667 (GRCm39) A492S probably damaging Het
Vmn1r213 A T 13: 23,195,932 (GRCm39) M172L probably benign Het
Vmn1r71 G A 7: 10,482,238 (GRCm39) T84I probably benign Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r77 T C 7: 86,450,702 (GRCm39) V196A probably benign Het
Xdh T A 17: 74,205,357 (GRCm39) H1036L probably damaging Het
Zfp930 T A 8: 69,680,948 (GRCm39) Y214* probably null Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123,306,826 (GRCm39) missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123,306,937 (GRCm39) missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123,286,621 (GRCm39) missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123,313,042 (GRCm39) missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123,292,861 (GRCm39) missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123,308,506 (GRCm39) missense probably benign 0.01
R0402:Vmn2r19 UTSW 6 123,313,141 (GRCm39) missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123,286,703 (GRCm39) missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123,313,102 (GRCm39) missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123,312,931 (GRCm39) missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123,313,132 (GRCm39) missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123,292,656 (GRCm39) missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123,313,411 (GRCm39) missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123,307,011 (GRCm39) missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123,308,597 (GRCm39) critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123,308,589 (GRCm39) missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123,292,880 (GRCm39) missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123,292,954 (GRCm39) missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123,292,954 (GRCm39) missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123,312,795 (GRCm39) missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123,293,033 (GRCm39) missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123,285,289 (GRCm39) splice site probably null
R2256:Vmn2r19 UTSW 6 123,306,845 (GRCm39) missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123,306,937 (GRCm39) missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123,292,548 (GRCm39) missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123,286,601 (GRCm39) missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123,292,587 (GRCm39) missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123,292,628 (GRCm39) missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123,306,871 (GRCm39) missense probably benign
R4574:Vmn2r19 UTSW 6 123,292,939 (GRCm39) missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123,286,800 (GRCm39) missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123,306,869 (GRCm39) missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123,286,602 (GRCm39) nonsense probably null
R5232:Vmn2r19 UTSW 6 123,312,916 (GRCm39) missense probably benign
R6102:Vmn2r19 UTSW 6 123,306,907 (GRCm39) missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123,293,054 (GRCm39) missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123,313,212 (GRCm39) missense probably benign
R6393:Vmn2r19 UTSW 6 123,293,112 (GRCm39) missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123,293,067 (GRCm39) missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123,313,494 (GRCm39) makesense probably null
R6742:Vmn2r19 UTSW 6 123,306,917 (GRCm39) missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123,308,521 (GRCm39) missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123,312,750 (GRCm39) missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123,292,998 (GRCm39) missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123,312,904 (GRCm39) missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123,313,221 (GRCm39) missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123,308,588 (GRCm39) missense probably damaging 1.00
R8937:Vmn2r19 UTSW 6 123,293,283 (GRCm39) critical splice donor site probably null
R9058:Vmn2r19 UTSW 6 123,313,021 (GRCm39) missense possibly damaging 0.53
R9119:Vmn2r19 UTSW 6 123,292,527 (GRCm39) missense possibly damaging 0.68
R9384:Vmn2r19 UTSW 6 123,292,923 (GRCm39) missense probably benign 0.00
X0058:Vmn2r19 UTSW 6 123,285,308 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123,285,298 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123,313,036 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCGGGACACACCCATTGTTAGAGC -3'
(R):5'- AAGGTGGACCCCTCATTACACCAG -3'

Sequencing Primer
(F):5'- GGCCAAACTAGAACAGTCACT -3'
(R):5'- GAGGATGATTTGCCCAAACTCTG -3'
Posted On 2013-04-24