Incidental Mutation 'R4133:Top2b'
ID314768
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16409189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.8018 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCATGGAGAAGTAAGCACTG -3'
(R):5'- TTTGAAGTACTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On2015-05-14