Incidental Mutation 'R4133:Bop1'
ID 314772
Institutional Source Beutler Lab
Gene Symbol Bop1
Ensembl Gene ENSMUSG00000022557
Gene Name block of proliferation 1
Synonyms Erb1p
MMRRC Submission 041637-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R4133 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76337188-76361449 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76338535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 469 (N469S)
Ref Sequence ENSEMBL: ENSMUSP00000023217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
AlphaFold P97452
Predicted Effect probably benign
Transcript: ENSMUST00000023217
AA Change: N469S

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557
AA Change: N469S

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043089
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229897
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229132
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,677,280 (GRCm39) noncoding transcript Het
Aldh3b1 A G 19: 3,970,808 (GRCm39) I184T probably damaging Het
Arhgap42 C T 9: 9,011,300 (GRCm39) probably benign Het
Arhgef4 A G 1: 34,845,185 (GRCm39) D1463G probably damaging Het
Arpc5 A G 1: 152,644,622 (GRCm39) T52A probably benign Het
Asb6 A G 2: 30,718,247 (GRCm39) probably benign Het
Ash1l T C 3: 88,889,567 (GRCm39) V482A probably benign Het
Btaf1 T A 19: 36,939,138 (GRCm39) N266K probably benign Het
Btla T C 16: 45,059,661 (GRCm39) Y122H probably damaging Het
Cacna1g A G 11: 94,323,370 (GRCm39) M1278T probably damaging Het
Cdc42bpb A G 12: 111,287,976 (GRCm39) S524P probably benign Het
Cep78 A G 19: 15,946,519 (GRCm39) S438P probably damaging Het
Clca4a T G 3: 144,675,113 (GRCm39) E171D probably benign Het
Cldn6 A T 17: 23,900,467 (GRCm39) I144F probably damaging Het
Cpd G A 11: 76,705,644 (GRCm39) Q363* probably null Het
Cpn1 G A 19: 43,974,723 (GRCm39) P2L possibly damaging Het
Ddx31 A G 2: 28,748,864 (GRCm39) D264G probably damaging Het
Ddx39b C T 17: 35,472,065 (GRCm39) S368L probably damaging Het
Ddx60 A G 8: 62,425,254 (GRCm39) K681E probably damaging Het
Dennd1c A C 17: 57,383,980 (GRCm39) W15G possibly damaging Het
Dgkd T G 1: 87,869,223 (GRCm39) probably null Het
Dnah7c G T 1: 46,705,150 (GRCm39) A2388S probably benign Het
Etv4 C A 11: 101,661,324 (GRCm39) K442N probably damaging Het
Fam234a T C 17: 26,432,532 (GRCm39) D539G probably damaging Het
Fancm A G 12: 65,167,304 (GRCm39) T1538A probably benign Het
Fbn2 A T 18: 58,229,034 (GRCm39) N725K possibly damaging Het
Fcer2a T A 8: 3,741,130 (GRCm39) N4I possibly damaging Het
Fgd5 T C 6: 92,046,418 (GRCm39) V1229A probably damaging Het
Garin4 A T 1: 190,895,205 (GRCm39) N479K probably benign Het
Gm5471 A T 15: 44,835,297 (GRCm39) noncoding transcript Het
Gm5478 T A 15: 101,553,080 (GRCm39) I331F probably damaging Het
Gm6729 C A 10: 86,377,030 (GRCm39) noncoding transcript Het
Hectd4 G T 5: 121,415,897 (GRCm39) probably null Het
Hspb3 A C 13: 113,800,027 (GRCm39) M1R probably null Het
Igkv10-95 T C 6: 68,657,601 (GRCm39) V19A probably damaging Het
Il1rap A G 16: 26,541,636 (GRCm39) S626G probably benign Het
Ints9 A G 14: 65,228,003 (GRCm39) H103R probably benign Het
Itga4 T A 2: 79,152,996 (GRCm39) D894E probably damaging Het
Khsrp T C 17: 57,332,605 (GRCm39) H225R probably benign Het
Lama1 T C 17: 68,057,650 (GRCm39) Y575H probably damaging Het
Lama1 A T 17: 68,119,481 (GRCm39) I2653F probably damaging Het
Map4k5 A T 12: 69,892,497 (GRCm39) L144Q probably damaging Het
Mcm5 A G 8: 75,842,482 (GRCm39) Y252C probably damaging Het
Mmgt2 A G 11: 62,555,877 (GRCm39) E75G probably damaging Het
Mroh2a A T 1: 88,182,687 (GRCm39) N1205I possibly damaging Het
Nckap5 A G 1: 126,150,443 (GRCm39) V162A probably benign Het
Nr3c2 T C 8: 77,636,378 (GRCm39) I493T probably damaging Het
Or2ag16 A C 7: 106,352,286 (GRCm39) L103R probably damaging Het
Or2t46 A T 11: 58,471,901 (GRCm39) Y77F probably damaging Het
Or9s15 T C 1: 92,524,465 (GRCm39) F75L probably benign Het
Papola A G 12: 105,765,917 (GRCm39) T6A possibly damaging Het
Ppp1cc G A 5: 122,306,289 (GRCm39) R36Q probably benign Het
Ptpro G T 6: 137,397,370 (GRCm39) W81C probably damaging Het
Rasgrf2 A G 13: 92,130,773 (GRCm39) S162P possibly damaging Het
Rpusd2 T C 2: 118,869,196 (GRCm39) S540P probably damaging Het
Scn5a T A 9: 119,315,438 (GRCm39) T1757S probably damaging Het
Setbp1 T C 18: 78,900,206 (GRCm39) I1154V probably benign Het
Sirt1 T C 10: 63,171,438 (GRCm39) I209V probably null Het
Slco6c1 T A 1: 97,009,218 (GRCm39) I406L probably benign Het
Smc2 A G 4: 52,450,947 (GRCm39) E255G probably damaging Het
Snap91 C A 9: 86,659,102 (GRCm39) G477V probably damaging Het
Speg A G 1: 75,404,548 (GRCm39) Q2780R probably benign Het
Spmap2 T C 10: 79,415,884 (GRCm39) T236A probably damaging Het
Ssh2 A G 11: 77,312,095 (GRCm39) Y196C probably damaging Het
Ssxb9 A T X: 8,235,845 (GRCm39) T18S probably damaging Het
Stxbp5l T C 16: 37,028,481 (GRCm39) I527M possibly damaging Het
Tex10 T C 4: 48,468,968 (GRCm39) Y69C probably damaging Het
Thoc3 T C 13: 54,616,361 (GRCm39) D87G probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trps1 T C 15: 50,694,783 (GRCm39) K213R probably damaging Het
Uggt1 A T 1: 36,197,240 (GRCm39) L1221Q probably damaging Het
Vmn2r3 T A 3: 64,183,138 (GRCm39) Y187F probably damaging Het
Washc2 G A 6: 116,235,891 (GRCm39) E1121K probably damaging Het
Zfx T C X: 93,124,464 (GRCm39) N360D probably damaging Het
Znhit3 A G 11: 84,807,139 (GRCm39) V10A probably benign Het
Other mutations in Bop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Bop1 APN 15 76,338,728 (GRCm39) missense probably benign 0.04
IGL01085:Bop1 APN 15 76,337,576 (GRCm39) missense probably damaging 1.00
IGL02157:Bop1 APN 15 76,339,772 (GRCm39) missense possibly damaging 0.70
R0332:Bop1 UTSW 15 76,340,187 (GRCm39) missense probably damaging 1.00
R2148:Bop1 UTSW 15 76,339,487 (GRCm39) missense probably damaging 0.96
R3979:Bop1 UTSW 15 76,338,076 (GRCm39) missense probably damaging 1.00
R5396:Bop1 UTSW 15 76,339,489 (GRCm39) missense probably damaging 1.00
R5434:Bop1 UTSW 15 76,339,611 (GRCm39) missense probably benign 0.01
R5666:Bop1 UTSW 15 76,338,433 (GRCm39) missense probably benign 0.00
R5820:Bop1 UTSW 15 76,339,041 (GRCm39) missense probably damaging 1.00
R5883:Bop1 UTSW 15 76,339,049 (GRCm39) missense probably damaging 1.00
R5907:Bop1 UTSW 15 76,340,117 (GRCm39) missense probably damaging 1.00
R6807:Bop1 UTSW 15 76,339,183 (GRCm39) missense probably damaging 0.99
R6947:Bop1 UTSW 15 76,338,188 (GRCm39) missense probably damaging 1.00
R7232:Bop1 UTSW 15 76,337,546 (GRCm39) missense probably damaging 1.00
R7395:Bop1 UTSW 15 76,338,041 (GRCm39) missense probably damaging 1.00
R7477:Bop1 UTSW 15 76,339,526 (GRCm39) missense probably damaging 1.00
R7725:Bop1 UTSW 15 76,339,583 (GRCm39) missense probably benign 0.23
R7792:Bop1 UTSW 15 76,338,548 (GRCm39) missense probably damaging 1.00
R8887:Bop1 UTSW 15 76,338,524 (GRCm39) missense probably damaging 0.98
R9292:Bop1 UTSW 15 76,351,031 (GRCm39) missense probably benign
R9487:Bop1 UTSW 15 76,338,076 (GRCm39) missense probably damaging 1.00
R9601:Bop1 UTSW 15 76,338,688 (GRCm39) missense probably benign 0.16
R9781:Bop1 UTSW 15 76,338,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATCACATACTTTGCTGTGG -3'
(R):5'- ATGGCACGTTGAAGCTCTGG -3'

Sequencing Primer
(F):5'- CTGTGGCAGATGCGTAGGC -3'
(R):5'- CCCGCTGTATGAAGACTGTACATG -3'
Posted On 2015-05-14