Incidental Mutation 'R4134:Nyap2'
ID314792
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Nameneuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
SynonymsJr6, 9430031J16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4134 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location81076950-81341764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81241193 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 310 (D310G)
Ref Sequence ENSEMBL: ENSMUSP00000065468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068275] [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
Predicted Effect probably damaging
Transcript: ENSMUST00000068275
AA Change: D310G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065468
Gene: ENSMUSG00000054976
AA Change: D310G

DomainStartEndE-ValueType
Pfam:NYAP_N 44 447 1.5e-139 PFAM
Pfam:NYAP_C 496 709 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113494
AA Change: D278G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976
AA Change: D278G

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123285
AA Change: D278G

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976
AA Change: D278G

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123720
AA Change: D310G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976
AA Change: D310G

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137862
AA Change: D278G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976
AA Change: D278G

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 T342A probably benign Het
Clip2 A G 5: 134,492,253 V977A probably benign Het
Cnot11 T C 1: 39,537,548 V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
F2 T C 2: 91,629,208 D410G possibly damaging Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Greb1l T C 18: 10,529,708 probably null Het
Gtdc1 A G 2: 44,825,418 W38R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 A T 4: 137,556,657 Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Itgb4 G T 11: 116,006,470 G1454V probably benign Het
Lrrc9 T C 12: 72,466,966 S534P probably benign Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Npm2 C T 14: 70,648,382 E128K possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pum1 A T 4: 130,764,069 I770F probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Syt9 A G 7: 107,436,423 S216G probably benign Het
Tep1 G A 14: 50,844,860 H1120Y probably benign Het
Ttn T A 2: 76,884,794 probably benign Het
Vmn1r8 A G 6: 57,036,720 D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 S638P probably damaging Het
Zfp677 A G 17: 21,397,781 T367A probably benign Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81192107 missense probably benign 0.03
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4298:Nyap2 UTSW 1 81241096 missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81087274 start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
R7558:Nyap2 UTSW 1 81269373 missense probably benign 0.01
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCATGTGCCAAGGAGAACC -3'
(R):5'- AGTGGAGACTCATCGGAATTGG -3'

Sequencing Primer
(F):5'- AGAACCTCTCTCCCGCGAG -3'
(R):5'- CTCATCGGAATTGGGAGAGC -3'
Posted On2015-05-14