Incidental Mutation 'R4134:F2'
ID314796
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4134 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91629208 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 410 (D410G)
Ref Sequence ENSEMBL: ENSMUSP00000106967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028681
AA Change: D411G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249
AA Change: D411G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111335
AA Change: D410G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249
AA Change: D410G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 T342A probably benign Het
Clip2 A G 5: 134,492,253 V977A probably benign Het
Cnot11 T C 1: 39,537,548 V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Greb1l T C 18: 10,529,708 probably null Het
Gtdc1 A G 2: 44,825,418 W38R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 A T 4: 137,556,657 Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Itgb4 G T 11: 116,006,470 G1454V probably benign Het
Lrrc9 T C 12: 72,466,966 S534P probably benign Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Npm2 C T 14: 70,648,382 E128K possibly damaging Het
Nyap2 A G 1: 81,241,193 D310G probably damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pum1 A T 4: 130,764,069 I770F probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Syt9 A G 7: 107,436,423 S216G probably benign Het
Tep1 G A 14: 50,844,860 H1120Y probably benign Het
Ttn T A 2: 76,884,794 probably benign Het
Vmn1r8 A G 6: 57,036,720 D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 S638P probably damaging Het
Zfp677 A G 17: 21,397,781 T367A probably benign Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R0830:F2 UTSW 2 91630200 missense probably benign 0.34
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4298:F2 UTSW 2 91629320 critical splice acceptor site probably null
R4626:F2 UTSW 2 91630670 missense probably benign 0.07
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5271:F2 UTSW 2 91635121 intron probably benign
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
R7762:F2 UTSW 2 91628696 missense possibly damaging 0.61
R8178:F2 UTSW 2 91630273 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACTTCCACCTGGACCATGTTC -3'
(R):5'- TTTCCAAGGCTGTTAGGGGC -3'

Sequencing Primer
(F):5'- ATACGGGCTTGCCCAGTGAG -3'
(R):5'- CTGGGCTCCAGCTCCTAATG -3'
Posted On2015-05-14