Incidental Mutation 'R4134:Syt9'
ID314808
Institutional Source Beutler Lab
Gene Symbol Syt9
Ensembl Gene ENSMUSG00000062542
Gene Namesynaptotagmin IX
SynonymsSytv
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4134 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107370728-107548656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107436423 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 216 (S216G)
Ref Sequence ENSEMBL: ENSMUSP00000073164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]
Predicted Effect probably benign
Transcript: ENSMUST00000073459
AA Change: S216G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: S216G

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 7e-54 BLAST
C2 236 339 1.8e-26 SMART
C2 368 482 1.6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130414
SMART Domains Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 3e-57 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137663
SMART Domains Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 T342A probably benign Het
Clip2 A G 5: 134,492,253 V977A probably benign Het
Cnot11 T C 1: 39,537,548 V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
F2 T C 2: 91,629,208 D410G possibly damaging Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Greb1l T C 18: 10,529,708 probably null Het
Gtdc1 A G 2: 44,825,418 W38R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 A T 4: 137,556,657 Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Itgb4 G T 11: 116,006,470 G1454V probably benign Het
Lrrc9 T C 12: 72,466,966 S534P probably benign Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Npm2 C T 14: 70,648,382 E128K possibly damaging Het
Nyap2 A G 1: 81,241,193 D310G probably damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pum1 A T 4: 130,764,069 I770F probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Tep1 G A 14: 50,844,860 H1120Y probably benign Het
Ttn T A 2: 76,884,794 probably benign Het
Vmn1r8 A G 6: 57,036,720 D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 S638P probably damaging Het
Zfp677 A G 17: 21,397,781 T367A probably benign Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Syt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Syt9 APN 7 107425367 nonsense probably null
IGL00541:Syt9 APN 7 107502180 missense probably null 1.00
IGL01161:Syt9 APN 7 107425149 missense probably damaging 0.97
IGL01705:Syt9 APN 7 107436352 missense probably damaging 0.96
IGL02567:Syt9 APN 7 107436661 missense probably damaging 1.00
IGL03268:Syt9 APN 7 107436405 missense probably benign 0.01
R0684:Syt9 UTSW 7 107425136 missense probably damaging 1.00
R0743:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R0835:Syt9 UTSW 7 107506530 missense probably benign 0.30
R0884:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R1114:Syt9 UTSW 7 107425355 missense possibly damaging 0.93
R1502:Syt9 UTSW 7 107436487 missense probably damaging 1.00
R1885:Syt9 UTSW 7 107436529 missense probably damaging 1.00
R1962:Syt9 UTSW 7 107425107 missense probably damaging 1.00
R2368:Syt9 UTSW 7 107436699 missense probably damaging 1.00
R2421:Syt9 UTSW 7 107436781 missense probably benign 0.39
R4477:Syt9 UTSW 7 107425221 missense probably damaging 1.00
R4602:Syt9 UTSW 7 107436387 nonsense probably null
R4685:Syt9 UTSW 7 107436471 missense possibly damaging 0.89
R4977:Syt9 UTSW 7 107504272 missense probably damaging 1.00
R5141:Syt9 UTSW 7 107504219 missense probably damaging 1.00
R5421:Syt9 UTSW 7 107425356 missense probably benign 0.00
R5440:Syt9 UTSW 7 107502123 missense possibly damaging 0.46
R5633:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R5978:Syt9 UTSW 7 107436413 missense probably benign 0.02
R6260:Syt9 UTSW 7 107436510 missense possibly damaging 0.93
R6733:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R6889:Syt9 UTSW 7 107425286 missense probably damaging 0.99
R7572:Syt9 UTSW 7 107436577 missense probably damaging 1.00
R8080:Syt9 UTSW 7 107436790 missense probably benign
X0018:Syt9 UTSW 7 107506574 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCTCATGAGGTTTTAACTCTGC -3'
(R):5'- AACACAGGGTTCAGGGTCTTC -3'

Sequencing Primer
(F):5'- CATGAGGTTTTAACTCTGCTGTGTC -3'
(R):5'- AGGGTCTTCCTGTGAACTTTAGTC -3'
Posted On2015-05-14