Incidental Mutation 'R4134:Greb1l'
ID 314825
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4134 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 10529708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172532] [ENSMUST00000172680] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably null
Transcript: ENSMUST00000048977
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048977
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1g T C 8: 93,319,872 (GRCm38) T342A probably benign Het
Clip2 A G 5: 134,492,253 (GRCm38) V977A probably benign Het
Cnot11 T C 1: 39,537,548 (GRCm38) V211A probably benign Het
Dcaf12l1 T C X: 44,789,453 (GRCm38) N156S probably damaging Het
Dennd2d T A 3: 106,482,661 (GRCm38) D2E probably benign Het
F2 T C 2: 91,629,208 (GRCm38) D410G possibly damaging Het
Gabrb3 G T 7: 57,591,288 (GRCm38) A5S probably benign Het
Gcnt2 T A 13: 40,887,807 (GRCm38) N147K probably damaging Het
Gtdc1 A G 2: 44,825,418 (GRCm38) W38R probably damaging Het
Hivep2 C A 10: 14,128,969 (GRCm38) T437K probably benign Het
Hspg2 A T 4: 137,556,657 (GRCm38) Q3446L probably damaging Het
Htr5a A G 5: 27,842,692 (GRCm38) M82V probably benign Het
Itgb4 G T 11: 116,006,470 (GRCm38) G1454V probably benign Het
Lrrc9 T C 12: 72,466,966 (GRCm38) S534P probably benign Het
Nkx6-1 T A 5: 101,659,505 (GRCm38) D337V probably damaging Het
Npm2 C T 14: 70,648,382 (GRCm38) E128K possibly damaging Het
Nyap2 A G 1: 81,241,193 (GRCm38) D310G probably damaging Het
Olfr168 T A 16: 19,530,702 (GRCm38) I73F possibly damaging Het
Olfr723 T C 14: 49,928,815 (GRCm38) H243R probably damaging Het
Pum1 A T 4: 130,764,069 (GRCm38) I770F probably damaging Het
Rreb1 A T 13: 37,947,123 (GRCm38) N1418Y probably damaging Het
Syt9 A G 7: 107,436,423 (GRCm38) S216G probably benign Het
Tep1 G A 14: 50,844,860 (GRCm38) H1120Y probably benign Het
Ttn T A 2: 76,884,794 (GRCm38) probably benign Het
Vmn1r8 A G 6: 57,036,720 (GRCm38) D252G probably benign Het
Vwa5b1 A T 4: 138,594,330 (GRCm38) M384K possibly damaging Het
Zfhx2 G A 14: 55,065,143 (GRCm38) P1795S possibly damaging Het
Zfhx4 T C 3: 5,243,627 (GRCm38) S638P probably damaging Het
Zfp677 A G 17: 21,397,781 (GRCm38) T367A probably benign Het
Zfp729a C A 13: 67,619,806 (GRCm38) C768F probably damaging Het
Zfp810 T C 9: 22,279,073 (GRCm38) K180E probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm38) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm38) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm38) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm38) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm38) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm38) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm38) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm38) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm38) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm38) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm38) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm38) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm38) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm38) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm38) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm38) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm38) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm38) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm38) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm38) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm38) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm38) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm38) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm38) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm38) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm38) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm38) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm38) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm38) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm38) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm38) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm38) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm38) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm38) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm38) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm38) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm38) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm38) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm38) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm38) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm38) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm38) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm38) missense probably damaging 0.99
R4342:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm38) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm38) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm38) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm38) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm38) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm38) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm38) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm38) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm38) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm38) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm38) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm38) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm38) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm38) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm38) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm38) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm38) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm38) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm38) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm38) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm38) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm38) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm38) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm38) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm38) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm38) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm38) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm38) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm38) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm38) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm38) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm38) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm38) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm38) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm38) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm38) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm38) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm38) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm38) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm38) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm38) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm38) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm38) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm38) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm38) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm38) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm38) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm38) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm38) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm38) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm38) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm38) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm38) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm38) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm38) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm38) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm38) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm38) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm38) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm38) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm38) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm38) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAACCTGTCTTCACGG -3'
(R):5'- GACAATCTGGGACGTGATAAAC -3'

Sequencing Primer
(F):5'- GCTCTGCTGTTTTCAATCAGGAG -3'
(R):5'- TGATAAACGGTACCGGCCC -3'
Posted On 2015-05-14