Incidental Mutation 'R4135:Dennd2d'
ID314836
Institutional Source Beutler Lab
Gene Symbol Dennd2d
Ensembl Gene ENSMUSG00000027901
Gene NameDENN/MADD domain containing 2D
Synonyms2010308M01Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4135 (G1)
Quality Score119
Status Validated
Chromosome3
Chromosomal Location106482405-106503030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106482661 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2 (D2E)
Ref Sequence ENSEMBL: ENSMUSP00000029508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029508] [ENSMUST00000149225] [ENSMUST00000183271]
Predicted Effect probably benign
Transcript: ENSMUST00000029508
AA Change: D2E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029508
Gene: ENSMUSG00000027901
AA Change: D2E

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
uDENN 47 139 4.15e-27 SMART
DENN 146 330 8.1e-71 SMART
dDENN 368 435 3.38e-18 SMART
low complexity region 447 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139062
Predicted Effect unknown
Transcript: ENSMUST00000149225
AA Change: D2E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164330
SMART Domains Protein: ENSMUSP00000127168
Gene: ENSMUSG00000091575

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183271
SMART Domains Protein: ENSMUSP00000138462
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
uDENN 57 149 4.15e-27 SMART
DENN 156 340 8.1e-71 SMART
dDENN 378 445 3.38e-18 SMART
low complexity region 457 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193651
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Dennd2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Dennd2d APN 3 106500545 missense possibly damaging 0.45
IGL01397:Dennd2d APN 3 106487049 critical splice donor site probably null 0.00
IGL01410:Dennd2d APN 3 106491226 missense probably damaging 1.00
IGL02022:Dennd2d APN 3 106499904 missense probably benign 0.00
IGL02032:Dennd2d APN 3 106491227 missense probably damaging 1.00
IGL02309:Dennd2d APN 3 106494968 missense probably benign
R0140:Dennd2d UTSW 3 106492483 missense probably benign 0.08
R0648:Dennd2d UTSW 3 106500555 missense probably damaging 0.97
R1519:Dennd2d UTSW 3 106492559 missense probably damaging 1.00
R1539:Dennd2d UTSW 3 106486920 missense probably benign 0.00
R1652:Dennd2d UTSW 3 106487001 missense probably benign 0.00
R1674:Dennd2d UTSW 3 106492517 missense probably benign 0.17
R2179:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R3731:Dennd2d UTSW 3 106499955 missense probably damaging 1.00
R4077:Dennd2d UTSW 3 106482623 unclassified probably benign
R4134:Dennd2d UTSW 3 106482661 missense probably benign 0.34
R5214:Dennd2d UTSW 3 106486321 critical splice donor site probably null
R5767:Dennd2d UTSW 3 106487815 intron probably benign
R6001:Dennd2d UTSW 3 106492460 missense probably benign 0.00
R6239:Dennd2d UTSW 3 106494877 missense probably damaging 1.00
R7312:Dennd2d UTSW 3 106491263 missense probably benign 0.38
R7593:Dennd2d UTSW 3 106499928 missense probably damaging 1.00
Z1088:Dennd2d UTSW 3 106499874 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGAGATGGTACCGCCC -3'
(R):5'- GCAGATCTGTCCCCTTGTTG -3'

Sequencing Primer
(F):5'- CCGAGAAGAGCGGCCAG -3'
(R):5'- GAGCTCACCTGCCTCCTG -3'
Posted On2015-05-14