Mutagenetix > Incidental Mutations

Incidental Mutation 'R4135:Cux1'

314842

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

040995-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4135 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136307896 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 921 (K921E)

Ref Sequence

ENSEMBL: ENSMUSP00000135086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004097
AA Change: K830E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: K830E

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148082

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175975
AA Change: K908E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: K908E

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176172
AA Change: K921E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: K921E

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176486
AA Change: K792E

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: K792E

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176778
AA Change: K913E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: K913E

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Meta Mutation Damage Score

0.1359

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	T	A	1: 160,077,522		probably benign	Het
9230110F15Rik	A	G	9: 35,839,428	S33P	possibly damaging	Het
Bak1	T	A	17: 27,021,270	T148S	possibly damaging	Het
Cdc25a	C	A	9: 109,881,517	H157Q	possibly damaging	Het
Chst5	T	C	8: 111,890,184	Y268C	probably damaging	Het
Csnk1g2	T	C	10: 80,638,296	I145T	possibly damaging	Het
Ctsr	T	C	13: 61,161,270	T224A	probably benign	Het
Dcaf12l1	T	C	X: 44,789,453	N156S	probably damaging	Het
Dennd2d	T	A	3: 106,482,661	D2E	probably benign	Het
Dock2	T	C	11: 34,714,501	K264E	possibly damaging	Het
Eif3c	C	G	7: 126,566,299		probably benign	Het
Gabrb3	G	T	7: 57,591,288	A5S	probably benign	Het
Gcnt2	T	A	13: 40,887,807	N147K	probably damaging	Het
Gm14139	A	T	2: 150,181,868		probably benign	Het
Gm6987	T	A	X: 94,024,610		noncoding transcript	Het
Hbp1	A	T	12: 31,934,422	L262Q	probably damaging	Het
Hsd11b2	T	C	8: 105,523,166	V303A	probably benign	Het
Htr5a	A	G	5: 27,842,692	M82V	probably benign	Het
Mcc	T	C	18: 44,724,640	D136G	probably benign	Het
Mrpl32	C	T	13: 14,612,979	V14M	probably damaging	Het
Msl1	A	G	11: 98,796,300	D157G	possibly damaging	Het
Mthfd1	G	A	12: 76,282,874		probably null	Het
Nkx6-1	T	A	5: 101,659,505	D337V	probably damaging	Het
Nlrp5	T	C	7: 23,418,398	W516R	possibly damaging	Het
Olfr131	A	G	17: 38,082,357	V207A	possibly damaging	Het
Olfr168	T	A	16: 19,530,702	I73F	possibly damaging	Het
Olfr312	C	A	11: 58,831,994	T280K	probably damaging	Het
Olfr705	A	G	7: 106,714,003	L226P	probably damaging	Het
Olfr723	T	C	14: 49,928,815	H243R	probably damaging	Het
Pold3	T	A	7: 100,100,647	R104*	probably null	Het
Rapsn	A	T	2: 91,036,817	N155Y	probably damaging	Het
Rorc	C	A	3: 94,389,519	Q269K	probably damaging	Het
Rreb1	A	T	13: 37,947,123	N1418Y	probably damaging	Het
Rusc2	G	A	4: 43,425,563	D1223N	possibly damaging	Het
Sema6d	T	C	2: 124,664,120	I616T	probably damaging	Het
Ttc6	T	A	12: 57,632,795		probably benign	Het
Ugt3a2	A	T	15: 9,338,724	Y58F	probably damaging	Het
Vmn2r-ps159	T	G	4: 156,338,790		noncoding transcript	Het
Vwa5b1	A	T	4: 138,594,330	M384K	possibly damaging	Het
Washc3	G	A	10: 88,219,280	E111K	probably benign	Het
Xirp2	A	G	2: 67,525,397	S3501G	probably benign	Het
Zfp352	C	T	4: 90,225,024	T467M	probably damaging	Het
Zfp729a	C	A	13: 67,619,806	C768F	probably damaging	Het
Zfp810	T	C	9: 22,279,073	K180E	probably damaging	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AATAGATGGGAAGCCATGCC -3'
(R):5'- AAGGCCGATGAAACAACTGC -3'

Sequencing Primer
(F):5'- ATGGGAAGCCATGCCTGTCC -3'
(R):5'- CGATGAAACAACTGCAAGCG -3'

Posted On

2015-05-14