Incidental Mutation 'R4135:Gabrb3'
ID314846
Institutional Source Beutler Lab
Gene Symbol Gabrb3
Ensembl Gene ENSMUSG00000033676
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 3
SynonymsA230092K12Rik, Gabrb-3, beta3
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R4135 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location57419692-57828802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57591288 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 5 (A5S)
Ref Sequence ENSEMBL: ENSMUSP00000038051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039697] [ENSMUST00000085240] [ENSMUST00000138350] [ENSMUST00000196198]
Predicted Effect probably benign
Transcript: ENSMUST00000039697
AA Change: A5S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038051
Gene: ENSMUSG00000033676
AA Change: A5S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 1.3e-53 PFAM
Pfam:Neur_chan_memb 250 468 2.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085240
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138350
SMART Domains Protein: ENSMUSP00000118835
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 123 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156375
Predicted Effect probably benign
Transcript: ENSMUST00000196198
SMART Domains Protein: ENSMUSP00000143353
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 9.7e-54 PFAM
Pfam:Neur_chan_memb 250 468 2e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mutants die at birth with cleft palate. Survivors show delayed growth, reduced lifespan, seizures, ataxia, hyperactivity, hyperresponsiveness and reduced learning, mothering ability and REM sleep. A point mutation lowers anesthetic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Gabrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Gabrb3 APN 7 57816478 missense probably benign 0.00
IGL01878:Gabrb3 APN 7 57816415 missense probably damaging 1.00
IGL02092:Gabrb3 APN 7 57765586 missense probably damaging 1.00
IGL02193:Gabrb3 APN 7 57792516 missense probably damaging 1.00
IGL02676:Gabrb3 APN 7 57591364 intron probably benign
R0325:Gabrb3 UTSW 7 57765530 missense probably damaging 1.00
R1560:Gabrb3 UTSW 7 57816295 missense probably damaging 0.98
R1562:Gabrb3 UTSW 7 57765514 nonsense probably null
R1714:Gabrb3 UTSW 7 57765428 missense probably damaging 1.00
R2054:Gabrb3 UTSW 7 57824493 missense probably benign 0.04
R4134:Gabrb3 UTSW 7 57591288 missense probably benign 0.01
R4176:Gabrb3 UTSW 7 57591313 missense probably benign 0.00
R4761:Gabrb3 UTSW 7 57765502 missense probably damaging 1.00
R4869:Gabrb3 UTSW 7 57792459 intron probably benign
R5247:Gabrb3 UTSW 7 57590591 missense possibly damaging 0.96
R6935:Gabrb3 UTSW 7 57591813 missense probably damaging 0.99
R7479:Gabrb3 UTSW 7 57824423 missense possibly damaging 0.74
R7562:Gabrb3 UTSW 7 57812178 nonsense probably null
R7692:Gabrb3 UTSW 7 57816455 missense probably damaging 1.00
X0064:Gabrb3 UTSW 7 57812185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGCTCTGAGGACTTG -3'
(R):5'- ATGTTCCCGGGGTCGTTTAC -3'

Sequencing Primer
(F):5'- AAGCTCTGAGGACTTGGCTCC -3'
(R):5'- TTTACGCTGAAGGAGGGGCAC -3'
Posted On2015-05-14