Incidental Mutation 'R4135:Pold3'
ID314847
Institutional Source Beutler Lab
Gene Symbol Pold3
Ensembl Gene ENSMUSG00000030726
Gene Namepolymerase (DNA-directed), delta 3, accessory subunit
SynonymsP66, C85233, P68, GC12, 2410142G14Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100082111-100121565 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 100100647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 104 (R104*)
Ref Sequence ENSEMBL: ENSMUSP00000146603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032969] [ENSMUST00000127128] [ENSMUST00000156202] [ENSMUST00000208184] [ENSMUST00000208670]
Predicted Effect probably null
Transcript: ENSMUST00000032969
AA Change: R143*
SMART Domains Protein: ENSMUSP00000032969
Gene: ENSMUSG00000030726
AA Change: R143*

DomainStartEndE-ValueType
Pfam:CDC27 19 461 1.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123675
Predicted Effect probably benign
Transcript: ENSMUST00000127128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129556
Predicted Effect silent
Transcript: ENSMUST00000156202
Predicted Effect probably null
Transcript: ENSMUST00000208184
AA Change: R37*
Predicted Effect probably null
Transcript: ENSMUST00000208670
AA Change: R104*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208704
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Pold3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Pold3 APN 7 100088145 splice site probably benign
IGL02101:Pold3 APN 7 100100496 missense probably damaging 0.99
IGL02402:Pold3 APN 7 100100411 splice site probably benign
IGL02541:Pold3 APN 7 100083672 missense probably damaging 1.00
IGL03145:Pold3 APN 7 100096512 missense probably damaging 1.00
R0522:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R1263:Pold3 UTSW 7 100119683 missense possibly damaging 0.65
R1956:Pold3 UTSW 7 100088111 missense probably benign 0.03
R2508:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R3933:Pold3 UTSW 7 100121401 missense probably damaging 1.00
R4354:Pold3 UTSW 7 100100617 missense possibly damaging 0.81
R5038:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R6060:Pold3 UTSW 7 100100612 nonsense probably null
R6118:Pold3 UTSW 7 100096407 missense possibly damaging 0.88
R6338:Pold3 UTSW 7 100088105 missense possibly damaging 0.94
R6466:Pold3 UTSW 7 100100632 missense probably benign 0.01
R7000:Pold3 UTSW 7 100106658 missense probably damaging 1.00
R8088:Pold3 UTSW 7 100112301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGTTTTAGTAGCAGC -3'
(R):5'- CAGGCCAAAGTTTCTTCTCCAC -3'

Sequencing Primer
(F):5'- GCAGCTTTAGAGATTAACATTCCC -3'
(R):5'- GCCTAGTTCTTTACCCAAATGGAG -3'
Posted On2015-05-14