Incidental Mutation 'R4135:Olfr705'
ID314848
Institutional Source Beutler Lab
Gene Symbol Olfr705
Ensembl Gene ENSMUSG00000109058
Gene Nameolfactory receptor 705
SynonymsGA_x6K02T2PBJ9-9256348-9255398, MOR283-2
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106871870-106876891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106714003 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Ref Sequence ENSEMBL: ENSMUSP00000149773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080925] [ENSMUST00000216868]
Predicted Effect probably damaging
Transcript: ENSMUST00000080925
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079726
Gene: ENSMUSG00000073900
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216868
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Olfr705
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Olfr705 APN 7 106714334 missense possibly damaging 0.48
IGL02203:Olfr705 APN 7 106714630 missense probably benign 0.02
IGL02342:Olfr705 APN 7 106714025 missense probably benign 0.13
IGL02544:Olfr705 APN 7 106714535 missense probably benign 0.39
IGL02569:Olfr705 APN 7 106714586 missense probably benign 0.00
PIT4651001:Olfr705 UTSW 7 106873523 missense probably damaging 1.00
R0501:Olfr705 UTSW 7 106714603 missense probably benign 0.01
R0504:Olfr705 UTSW 7 106714701 splice site probably benign
R0536:Olfr705 UTSW 7 106714321 missense probably damaging 1.00
R0633:Olfr705 UTSW 7 106713977 missense probably benign 0.03
R0686:Olfr705 UTSW 7 106714378 missense probably damaging 0.98
R1225:Olfr705 UTSW 7 106714524 missense probably benign 0.22
R1725:Olfr705 UTSW 7 106714058 missense probably benign
R1864:Olfr705 UTSW 7 106713823 missense possibly damaging 0.87
R2065:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2068:Olfr705 UTSW 7 106714166 missense probably benign 0.12
R2081:Olfr705 UTSW 7 106714198 missense probably benign
R5649:Olfr705 UTSW 7 106714166 missense possibly damaging 0.89
R5858:Olfr705 UTSW 7 106873768 missense probably benign 0.01
R6083:Olfr705 UTSW 7 106873582 missense probably damaging 0.98
R7144:Olfr705 UTSW 7 106873868 missense probably damaging 1.00
R7214:Olfr705 UTSW 7 106874267 start gained probably benign
R7366:Olfr705 UTSW 7 106873396 missense probably damaging 1.00
R7445:Olfr705 UTSW 7 106873342 missense possibly damaging 0.55
R8171:Olfr705 UTSW 7 106714618 missense probably benign
R8171:Olfr705 UTSW 7 106714619 missense
Predicted Primers PCR Primer
(F):5'- CAGAGCTGGAGTGACAATCATG -3'
(R):5'- GCATCTCTCAGTGCTCTAGG -3'

Sequencing Primer
(F):5'- TGACAATCATGTAGAAAACTGAGCTG -3'
(R):5'- GCATCTCTCAGTGCTCTAGGATATAG -3'
Posted On2015-05-14