Incidental Mutation 'R4135:Eif3c'
ID314849
Institutional Source Beutler Lab
Gene Symbol Eif3c
Ensembl Gene ENSMUSG00000030738
Gene Nameeukaryotic translation initiation factor 3, subunit C
SynonymsNIPIL(A3), 3230401O13Rik, 110kDa, Xs, Eif3s8, Xsl
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126546455-126566411 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 126566299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032992] [ENSMUST00000084589] [ENSMUST00000180459] [ENSMUST00000205949]
Predicted Effect probably benign
Transcript: ENSMUST00000032992
SMART Domains Protein: ENSMUSP00000032992
Gene: ENSMUSG00000030738

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:eIF-3c_N 29 703 9.6e-267 PFAM
PINT 776 864 9.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083407
Predicted Effect probably benign
Transcript: ENSMUST00000084589
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122504
Predicted Effect probably benign
Transcript: ENSMUST00000180459
SMART Domains Protein: ENSMUSP00000138023
Gene: ENSMUSG00000030738

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 113 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205949
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mutations in this gene result in a range of abnormal limb development, including polydactyly, and white coat spotting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Eif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Eif3c APN 7 126559008 missense probably benign
IGL01380:Eif3c APN 7 126564413 intron probably benign
IGL01434:Eif3c APN 7 126556410 missense probably damaging 0.99
IGL01534:Eif3c APN 7 126557695 missense probably benign 0.07
IGL02493:Eif3c APN 7 126558901 missense probably damaging 0.98
IGL02544:Eif3c APN 7 126547612 nonsense probably null
IGL02821:Eif3c APN 7 126558659 missense probably benign
IGL02963:Eif3c APN 7 126556820 missense probably benign 0.00
R0194:Eif3c UTSW 7 126558623 unclassified probably benign
R0421:Eif3c UTSW 7 126563712 missense possibly damaging 0.95
R1486:Eif3c UTSW 7 126564721 missense probably damaging 1.00
R2378:Eif3c UTSW 7 126552325 missense probably damaging 0.99
R4223:Eif3c UTSW 7 126566299 unclassified probably benign
R4225:Eif3c UTSW 7 126566299 unclassified probably benign
R4898:Eif3c UTSW 7 126557454 missense probably benign 0.03
R5144:Eif3c UTSW 7 126563066 missense probably benign
R5246:Eif3c UTSW 7 126557238 missense possibly damaging 0.66
R5845:Eif3c UTSW 7 126564755 missense probably damaging 0.99
R6495:Eif3c UTSW 7 126547500 missense probably damaging 1.00
R6884:Eif3c UTSW 7 126556879 missense probably benign 0.01
R7236:Eif3c UTSW 7 126552323 missense possibly damaging 0.63
R7691:Eif3c UTSW 7 126551990 missense possibly damaging 0.95
R7744:Eif3c UTSW 7 126558894 missense probably damaging 1.00
X0065:Eif3c UTSW 7 126552085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCACTGTTTGCCGTAG -3'
(R):5'- GCCACTGGGAATTGTAGTTATTTAG -3'

Sequencing Primer
(F):5'- GTTTGGTGACGAGCTCCTCC -3'
(R):5'- GGAATTGTAGTTATTTAGCGCATTC -3'
Posted On2015-05-14