Incidental Mutation 'R4135:Hsd11b2'
ID314850
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Namehydroxysteroid 11-beta dehydrogenase 2
Synonyms11HSD2, 11(beta)-HSD2
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105518755-105523988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105523166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]
Predicted Effect probably benign
Transcript: ENSMUST00000013304
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034363
AA Change: V303A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: V303A

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 105523151 missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R5780:Hsd11b2 UTSW 8 105522155 missense probably damaging 1.00
R6058:Hsd11b2 UTSW 8 105523334 missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 105518874 missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 105519103 missense possibly damaging 0.95
R8110:Hsd11b2 UTSW 8 105522634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAAGACAGGTGAGGGTTCAG -3'
(R):5'- TTCTGTAGGAAGCAGCGTCG -3'

Sequencing Primer
(F):5'- ACAGGCGTGGTTTACATTAAATAG -3'
(R):5'- GAAGCAGCGTCGCAGGC -3'
Posted On2015-05-14