Mutagenetix > Incidental Mutation

Incidental Mutation 'R4135:Hsd11b2'

314850

Institutional Source

Beutler Lab

Gene Symbol

Hsd11b2

Ensembl Gene

ENSMUSG00000031891

Gene Name

hydroxysteroid 11-beta dehydrogenase 2

Synonyms

11(beta)-HSD2, 11HSD2

MMRRC Submission

040995-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4135 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106245387-106250620 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106249798 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 303 (V303A)

Ref Sequence

ENSEMBL: ENSMUSP00000034363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]

AlphaFold

P51661

Predicted Effect

probably benign
Transcript: ENSMUST00000013304

SMART Domains

Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

Domain	Start	End	E-Value	Type
Pfam:vATP-synt_AC39	16	347	2.4e-116	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000034363
AA Change: V303A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: V303A

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
low complexity region	34	44	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Pfam:adh_short	83	278	9.2e-47	PFAM
Pfam:adh_short_C2	89	294	2e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	T	A	1: 159,905,092 (GRCm39)		probably benign	Het
Bak1	T	A	17: 27,240,244 (GRCm39)	T148S	possibly damaging	Het
Cdc25a	C	A	9: 109,710,585 (GRCm39)	H157Q	possibly damaging	Het
Chst5	T	C	8: 112,616,816 (GRCm39)	Y268C	probably damaging	Het
Csnk1g2	T	C	10: 80,474,130 (GRCm39)	I145T	possibly damaging	Het
Ctsr	T	C	13: 61,309,084 (GRCm39)	T224A	probably benign	Het
Cux1	T	C	5: 136,336,750 (GRCm39)	K921E	probably damaging	Het
Dcaf12l1	T	C	X: 43,878,330 (GRCm39)	N156S	probably damaging	Het
Dennd2d	T	A	3: 106,389,977 (GRCm39)	D2E	probably benign	Het
Dock2	T	C	11: 34,605,328 (GRCm39)	K264E	possibly damaging	Het
Eif3c	C	G	7: 126,165,471 (GRCm39)		probably benign	Het
Gabrb3	G	T	7: 57,241,036 (GRCm39)	A5S	probably benign	Het
Gcnt2	T	A	13: 41,041,283 (GRCm39)	N147K	probably damaging	Het
Gm6987	T	A	X: 93,068,216 (GRCm39)		noncoding transcript	Het
Hbp1	A	T	12: 31,984,421 (GRCm39)	L262Q	probably damaging	Het
Htr5a	A	G	5: 28,047,690 (GRCm39)	M82V	probably benign	Het
Mcc	T	C	18: 44,857,707 (GRCm39)	D136G	probably benign	Het
Mrpl32	C	T	13: 14,787,564 (GRCm39)	V14M	probably damaging	Het
Msl1	A	G	11: 98,687,126 (GRCm39)	D157G	possibly damaging	Het
Mthfd1	G	A	12: 76,329,648 (GRCm39)		probably null	Het
Nkx6-1	T	A	5: 101,807,371 (GRCm39)	D337V	probably damaging	Het
Nlrp5	T	C	7: 23,117,823 (GRCm39)	W516R	possibly damaging	Het
Or2ag1	A	G	7: 106,313,210 (GRCm39)	L226P	probably damaging	Het
Or2l13b	T	A	16: 19,349,452 (GRCm39)	I73F	possibly damaging	Het
Or2y3	A	G	17: 38,393,248 (GRCm39)	V207A	possibly damaging	Het
Or4l1	T	C	14: 50,166,272 (GRCm39)	H243R	probably damaging	Het
Or5af1	C	A	11: 58,722,820 (GRCm39)	T280K	probably damaging	Het
Pate5	A	G	9: 35,750,724 (GRCm39)	S33P	possibly damaging	Het
Pold3	T	A	7: 99,749,854 (GRCm39)	R104*	probably null	Het
Rapsn	A	T	2: 90,867,162 (GRCm39)	N155Y	probably damaging	Het
Rorc	C	A	3: 94,296,826 (GRCm39)	Q269K	probably damaging	Het
Rreb1	A	T	13: 38,131,099 (GRCm39)	N1418Y	probably damaging	Het
Rusc2	G	A	4: 43,425,563 (GRCm39)	D1223N	possibly damaging	Het
Sema6d	T	C	2: 124,506,040 (GRCm39)	I616T	probably damaging	Het
Ttc6	T	A	12: 57,679,581 (GRCm39)		probably benign	Het
Ugt3a1	A	T	15: 9,338,810 (GRCm39)	Y58F	probably damaging	Het
Vmn2r129	T	G	4: 156,691,085 (GRCm39)		noncoding transcript	Het
Vwa5b1	A	T	4: 138,321,641 (GRCm39)	M384K	possibly damaging	Het
Washc3	G	A	10: 88,055,142 (GRCm39)	E111K	probably benign	Het
Xirp2	A	G	2: 67,355,741 (GRCm39)	S3501G	probably benign	Het
Zfp1004	A	T	2: 150,023,788 (GRCm39)		probably benign	Het
Zfp352	C	T	4: 90,113,261 (GRCm39)	T467M	probably damaging	Het
Zfp729a	C	A	13: 67,767,925 (GRCm39)	C768F	probably damaging	Het
Zfp810	T	C	9: 22,190,369 (GRCm39)	K180E	probably damaging	Het

Other mutations in Hsd11b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Hsd11b2	APN	8	106,249,759 (GRCm39)	missense	probably benign	0.06
IGL01620:Hsd11b2	APN	8	106,249,529 (GRCm39)	missense	probably benign	0.04
IGL02257:Hsd11b2	APN	8	106,249,854 (GRCm39)	missense	probably benign	0.04
IGL02655:Hsd11b2	APN	8	106,248,960 (GRCm39)	missense	probably benign	0.00
gilberto	UTSW	8	106,249,699 (GRCm39)	missense	possibly damaging	0.96
R0254:Hsd11b2	UTSW	8	106,249,699 (GRCm39)	missense	possibly damaging	0.96
R1082:Hsd11b2	UTSW	8	106,249,783 (GRCm39)	missense	probably damaging	0.99
R2050:Hsd11b2	UTSW	8	106,249,992 (GRCm39)	missense	probably benign	0.27
R5294:Hsd11b2	UTSW	8	106,249,929 (GRCm39)	missense	probably benign	0.01
R5598:Hsd11b2	UTSW	8	106,249,143 (GRCm39)	missense	probably benign
R5780:Hsd11b2	UTSW	8	106,248,787 (GRCm39)	missense	probably damaging	1.00
R6058:Hsd11b2	UTSW	8	106,249,966 (GRCm39)	missense	possibly damaging	0.59
R6867:Hsd11b2	UTSW	8	106,248,949 (GRCm39)	missense	probably benign	0.00
R7535:Hsd11b2	UTSW	8	106,245,755 (GRCm39)	missense	probably damaging	0.99
R7786:Hsd11b2	UTSW	8	106,245,506 (GRCm39)	missense	probably damaging	0.99
R8006:Hsd11b2	UTSW	8	106,245,735 (GRCm39)	missense	possibly damaging	0.95
R8110:Hsd11b2	UTSW	8	106,249,266 (GRCm39)	missense	probably damaging	0.98
R8889:Hsd11b2	UTSW	8	106,249,263 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAAGACAGGTGAGGGTTCAG -3'
(R):5'- TTCTGTAGGAAGCAGCGTCG -3'

Sequencing Primer
(F):5'- ACAGGCGTGGTTTACATTAAATAG -3'
(R):5'- GAAGCAGCGTCGCAGGC -3'

Posted On

2015-05-14