Incidental Mutation 'R4135:Cdc25a'
ID314854
Institutional Source Beutler Lab
Gene Symbol Cdc25a
Ensembl Gene ENSMUSG00000032477
Gene Namecell division cycle 25A
SynonymsD9Ertd393e
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109875579-109893895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109881517 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 157 (H157Q)
Ref Sequence ENSEMBL: ENSMUSP00000091882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094324] [ENSMUST00000198308] [ENSMUST00000198848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094324
AA Change: H157Q

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091882
Gene: ENSMUSG00000032477
AA Change: H157Q

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 85 318 3.6e-69 PFAM
RHOD 356 469 2.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197945
Predicted Effect probably benign
Transcript: ENSMUST00000198308
AA Change: H96Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142958
Gene: ENSMUSG00000032477
AA Change: H96Q

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 24 258 1.2e-88 PFAM
RHOD 295 408 5.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198848
Predicted Effect probably benign
Transcript: ENSMUST00000199787
Meta Mutation Damage Score 0.1650 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit elevated levels of early erythroid progenitor cell cycling but erythropoiesis is normally unaffected. Homozygous deletion of this gene is lethal and male heterozygotes display decreased vertebral trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Cdc25a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cdc25a APN 9 109876126 splice site probably null
IGL01761:Cdc25a APN 9 109891865 intron probably benign
IGL02808:Cdc25a APN 9 109883599 splice site probably null
IGL03241:Cdc25a APN 9 109884199 splice site probably null
P4748:Cdc25a UTSW 9 109884108 splice site probably benign
R1472:Cdc25a UTSW 9 109876089 missense probably benign 0.00
R1571:Cdc25a UTSW 9 109881546 missense possibly damaging 0.56
R1598:Cdc25a UTSW 9 109879893 frame shift probably null
R4301:Cdc25a UTSW 9 109889742 missense probably benign 0.23
R4386:Cdc25a UTSW 9 109889733 missense probably damaging 1.00
R5074:Cdc25a UTSW 9 109884140 missense possibly damaging 0.46
R5171:Cdc25a UTSW 9 109877161 missense probably benign 0.25
R5896:Cdc25a UTSW 9 109884365 missense probably benign 0.00
R5928:Cdc25a UTSW 9 109889793 missense probably damaging 1.00
R6223:Cdc25a UTSW 9 109889774 missense possibly damaging 0.85
R6240:Cdc25a UTSW 9 109884158 missense probably damaging 1.00
R6440:Cdc25a UTSW 9 109881498 missense probably benign
R6854:Cdc25a UTSW 9 109879927 missense probably damaging 1.00
R7219:Cdc25a UTSW 9 109889086 missense probably damaging 0.99
R7980:Cdc25a UTSW 9 109879881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAAGCCATCTCTCTAGAC -3'
(R):5'- CCAGTTAATTCATAGGCCTCAGC -3'

Sequencing Primer
(F):5'- GCACATGAAGACAGGTCAGCTTTC -3'
(R):5'- ACAGGATTTCATGTAGCCCAGGC -3'
Posted On2015-05-14