Incidental Mutation 'R4135:Csnk1g2'
ID314855
Institutional Source Beutler Lab
Gene Symbol Csnk1g2
Ensembl Gene ENSMUSG00000003345
Gene Namecasein kinase 1, gamma 2
Synonyms
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80622838-80640749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80638296 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 145 (I145T)
Ref Sequence ENSEMBL: ENSMUSP00000082560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000079773] [ENSMUST00000085435] [ENSMUST00000126980]
Predicted Effect probably benign
Transcript: ENSMUST00000003434
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079773
AA Change: I172T

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078706
Gene: ENSMUSG00000003345
AA Change: I172T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase 126 329 2e-19 PFAM
Pfam:Pkinase_Tyr 128 329 6.2e-10 PFAM
Pfam:CK1gamma_C 382 412 4e-11 PFAM
low complexity region 425 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085435
AA Change: I145T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082560
Gene: ENSMUSG00000003345
AA Change: I145T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 308 1.3e-14 PFAM
Pfam:Pkinase 46 313 7.6e-35 PFAM
Pfam:CK1gamma_C 354 385 1.2e-11 PFAM
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126980
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220025
Predicted Effect probably benign
Transcript: ENSMUST00000220163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220431
Meta Mutation Damage Score 0.2787 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Csnk1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Csnk1g2 APN 10 80634647 unclassified probably benign
IGL01657:Csnk1g2 APN 10 80639629 missense probably benign 0.02
IGL01920:Csnk1g2 APN 10 80638428 missense probably damaging 1.00
IGL02887:Csnk1g2 APN 10 80638535 missense probably damaging 1.00
R2845:Csnk1g2 UTSW 10 80638604 missense probably damaging 1.00
R4626:Csnk1g2 UTSW 10 80639814 missense probably damaging 0.98
R4717:Csnk1g2 UTSW 10 80637915 missense probably benign 0.36
R4729:Csnk1g2 UTSW 10 80639204 missense probably benign 0.01
R5546:Csnk1g2 UTSW 10 80638398 missense probably benign 0.36
R6000:Csnk1g2 UTSW 10 80638944 missense probably damaging 0.99
R6415:Csnk1g2 UTSW 10 80638296 missense possibly damaging 0.84
R6449:Csnk1g2 UTSW 10 80640072 missense probably damaging 1.00
R7144:Csnk1g2 UTSW 10 80637899 missense probably damaging 1.00
R7263:Csnk1g2 UTSW 10 80634498 missense probably damaging 0.97
R7316:Csnk1g2 UTSW 10 80639853 missense possibly damaging 0.95
R8169:Csnk1g2 UTSW 10 80639802 missense probably damaging 1.00
R8171:Csnk1g2 UTSW 10 80639802 missense probably damaging 1.00
R8227:Csnk1g2 UTSW 10 80638629 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTACAAGCAGCTCAGCACGAC -3'
(R):5'- GCCCAAAGTCGATGATGTGG -3'

Sequencing Primer
(F):5'- ACTCCTAGGCCAGCAGTG -3'
(R):5'- AGTGCTGCCGCTTGCTG -3'
Posted On2015-05-14