Incidental Mutation 'R4135:Washc3'
ID314856
Institutional Source Beutler Lab
Gene Symbol Washc3
Ensembl Gene ENSMUSG00000020056
Gene NameWASH complex subunit 3
Synonyms5730495F03Rik, Ccdc53, 2900091E11Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88201093-88246158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88219280 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 111 (E111K)
Ref Sequence ENSEMBL: ENSMUSP00000138310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020248] [ENSMUST00000171151] [ENSMUST00000182183] [ENSMUST00000182299] [ENSMUST00000182619]
Predicted Effect probably benign
Transcript: ENSMUST00000020248
AA Change: E119K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020248
Gene: ENSMUSG00000020056
AA Change: E119K

DomainStartEndE-ValueType
Pfam:DUF2360 30 167 1.8e-51 PFAM
low complexity region 177 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171151
AA Change: E119K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132246
Gene: ENSMUSG00000020056
AA Change: E119K

DomainStartEndE-ValueType
Pfam:DUF2360 30 167 3.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182183
AA Change: E118K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138540
Gene: ENSMUSG00000020056
AA Change: E118K

DomainStartEndE-ValueType
Pfam:DUF2360 30 167 5.5e-52 PFAM
low complexity region 176 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182299
SMART Domains Protein: ENSMUSP00000138261
Gene: ENSMUSG00000020056

DomainStartEndE-ValueType
Pfam:DUF2360 30 50 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182359
Predicted Effect probably benign
Transcript: ENSMUST00000182619
AA Change: E111K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138310
Gene: ENSMUSG00000020056
AA Change: E111K

DomainStartEndE-ValueType
Pfam:DUF2360 23 159 7.3e-41 PFAM
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Washc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Washc3 APN 10 88201825 missense probably damaging 1.00
R3780:Washc3 UTSW 10 88219260 missense probably benign 0.29
R4489:Washc3 UTSW 10 88216031 missense probably benign 0.06
R4538:Washc3 UTSW 10 88216009 missense probably benign 0.25
R4763:Washc3 UTSW 10 88219323 missense probably damaging 1.00
R4773:Washc3 UTSW 10 88219262 nonsense probably null
R6572:Washc3 UTSW 10 88213706 missense probably benign 0.01
R6933:Washc3 UTSW 10 88201852 missense probably damaging 0.98
R7064:Washc3 UTSW 10 88245773 missense possibly damaging 0.94
R7803:Washc3 UTSW 10 88216075 critical splice donor site probably null
R8120:Washc3 UTSW 10 88201297 splice site probably null
X0065:Washc3 UTSW 10 88234431 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CATTGCATCTCAGGAACAATCTG -3'
(R):5'- GAAAACTTGGTCTTTCTGGTTAGC -3'

Sequencing Primer
(F):5'- GCTATTTGGGAATGAATATCC -3'
(R):5'- CTGGTTAGCAGTTTTCTTAGACTAG -3'
Posted On2015-05-14