Incidental Mutation 'R4135:Olfr312'
ID314858
Institutional Source Beutler Lab
Gene Symbol Olfr312
Ensembl Gene ENSMUSG00000096806
Gene Nameolfactory receptor 312
SynonymsGA_x6K02T2NKPP-575829-574903, MOR222-4P
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58829237-58834780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58831994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 280 (T280K)
Ref Sequence ENSEMBL: ENSMUSP00000149697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078217] [ENSMUST00000216407]
Predicted Effect probably damaging
Transcript: ENSMUST00000078217
AA Change: T280K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077344
Gene: ENSMUSG00000096806
AA Change: T280K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.9e-8 PFAM
Pfam:7tm_1 39 288 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216407
AA Change: T280K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Olfr312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Olfr312 APN 11 58831639 missense probably damaging 1.00
R0442:Olfr312 UTSW 11 58831431 nonsense probably null
R0540:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R0607:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R2366:Olfr312 UTSW 11 58831213 missense probably benign 0.00
R3437:Olfr312 UTSW 11 58831324 missense probably damaging 1.00
R4391:Olfr312 UTSW 11 58832015 missense possibly damaging 0.81
R5557:Olfr312 UTSW 11 58831987 missense probably benign 0.01
R5564:Olfr312 UTSW 11 58831213 nonsense probably null
R5854:Olfr312 UTSW 11 58831556 missense probably damaging 0.99
R6791:Olfr312 UTSW 11 58832077 missense probably benign
R7336:Olfr312 UTSW 11 58831924 missense probably damaging 0.99
R7344:Olfr312 UTSW 11 58831482 missense probably damaging 1.00
R7397:Olfr312 UTSW 11 58831289 missense probably benign 0.05
X0067:Olfr312 UTSW 11 58831988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCACAGTGGTCTCCTATATTGG -3'
(R):5'- TGAGCAATGTCAAGGGTCCC -3'

Sequencing Primer
(F):5'- GCATTGTGGCCACAGTTC -3'
(R):5'- TGTCAAGGGTCCCAGGAG -3'
Posted On2015-05-14