Incidental Mutation 'R4135:Msl1'
ID314859
Institutional Source Beutler Lab
Gene Symbol Msl1
Ensembl Gene ENSMUSG00000052915
Gene Namemale specific lethal 1
Synonyms4121402D02Rik, 4930463F05Rik, 2810017F12Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4135 (G1)
Quality Score138
Status Validated
Chromosome11
Chromosomal Location98795516-98807859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98796300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 157 (D157G)
Ref Sequence ENSEMBL: ENSMUSP00000103111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107485] [ENSMUST00000107487]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037915
AA Change: D157G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
Pfam:MSL1_dimer 216 252 5e-22 PFAM
low complexity region 289 300 N/A INTRINSIC
low complexity region 441 453 N/A INTRINSIC
PEHE 475 593 1.8e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037930
SMART Domains Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
coiled coil region 18 56 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
PEHE 229 347 2.73e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107485
AA Change: D157G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103109
Gene: ENSMUSG00000052915
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 2e-3 SMART
low complexity region 441 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107487
AA Change: D157G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 6e-3 SMART
low complexity region 441 453 N/A INTRINSIC
PEHE 459 577 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126969
SMART Domains Protein: ENSMUSP00000116598
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Pfam:PEHE 88 141 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153181
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Msl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Msl1 APN 11 98805421 missense probably damaging 1.00
IGL01743:Msl1 APN 11 98805419 missense probably damaging 1.00
IGL01845:Msl1 APN 11 98805365 splice site probably null
R1458:Msl1 UTSW 11 98803982 splice site probably benign
R2377:Msl1 UTSW 11 98803963 missense probably damaging 1.00
R2979:Msl1 UTSW 11 98800224 missense possibly damaging 0.91
R4801:Msl1 UTSW 11 98803969 nonsense probably null
R4802:Msl1 UTSW 11 98803969 nonsense probably null
R5971:Msl1 UTSW 11 98798693 missense probably benign 0.30
R6079:Msl1 UTSW 11 98798693 missense probably benign 0.30
R6165:Msl1 UTSW 11 98804847 missense probably damaging 1.00
R6733:Msl1 UTSW 11 98800056 missense probably damaging 1.00
R6737:Msl1 UTSW 11 98804082 missense probably damaging 1.00
R7654:Msl1 UTSW 11 98796111 missense possibly damaging 0.72
R8316:Msl1 UTSW 11 98800248 missense probably damaging 0.98
U15987:Msl1 UTSW 11 98798693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCATCGTAAGCTCAAGGAG -3'
(R):5'- AAGGATCTGTTTGAGGCAGG -3'

Sequencing Primer
(F):5'- GGGCTTGTTACTCCCAGC -3'
(R):5'- TGACTGGAGGCTCCCGAG -3'
Posted On2015-05-14