Incidental Mutation 'R4135:Hbp1'
ID314860
Institutional Source Beutler Lab
Gene Symbol Hbp1
Ensembl Gene ENSMUSG00000002996
Gene Namehigh mobility group box transcription factor 1
Synonyms1700058O05Rik, C86454, C330012F01Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31926254-31950535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31934422 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 262 (L262Q)
Ref Sequence ENSEMBL: ENSMUSP00000135155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000167458] [ENSMUST00000172314] [ENSMUST00000175686] [ENSMUST00000176084] [ENSMUST00000176103] [ENSMUST00000176520]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167458
AA Change: L272Q

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131983
Gene: ENSMUSG00000002996
AA Change: L272Q

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 6e-7 PDB
low complexity region 406 424 N/A INTRINSIC
PDB:2E6O|A 437 474 6e-20 PDB
SCOP:d1cg7a_ 443 474 2e-9 SMART
Blast:HMG 445 474 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172314
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131158
Gene: ENSMUSG00000002996
AA Change: L272Q

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 7e-7 PDB
low complexity region 406 424 N/A INTRINSIC
HMG 445 515 8.7e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175686
AA Change: L276Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135080
Gene: ENSMUSG00000002996
AA Change: L276Q

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
AXH 224 354 1.35e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176084
SMART Domains Protein: ENSMUSP00000135489
Gene: ENSMUSG00000002996

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
PDB:3QVE|C 206 230 7e-10 PDB
Blast:AXH 210 230 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176103
SMART Domains Protein: ENSMUSP00000135508
Gene: ENSMUSG00000002996

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
PDB:1V06|A 218 265 1e-28 PDB
Blast:AXH 220 265 1e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176138
Predicted Effect probably damaging
Transcript: ENSMUST00000176520
AA Change: L262Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135155
Gene: ENSMUSG00000002996
AA Change: L262Q

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
Pfam:AXH 215 288 3.1e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176643
AA Change: L97Q
Meta Mutation Damage Score 0.8940 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele have behavioral abnormalities and show alterations in leukocyte, platelet and NK cell number, blood urea nitrogen levels, and circulating amylase and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Hbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Hbp1 APN 12 31930675 unclassified probably benign
Sliver UTSW 12 31937247 missense probably damaging 0.99
R4569:Hbp1 UTSW 12 31950232 unclassified probably benign
R5324:Hbp1 UTSW 12 31928618 missense probably damaging 1.00
R5910:Hbp1 UTSW 12 31937652 missense probably benign 0.19
R5936:Hbp1 UTSW 12 31937096 splice site probably null
R6062:Hbp1 UTSW 12 31937247 missense probably damaging 0.99
R6439:Hbp1 UTSW 12 31937721 missense probably damaging 1.00
R7017:Hbp1 UTSW 12 31943853 missense probably damaging 1.00
R7213:Hbp1 UTSW 12 31937197 missense probably benign 0.00
R7519:Hbp1 UTSW 12 31933375 missense probably damaging 1.00
R7626:Hbp1 UTSW 12 31943900 missense probably benign 0.45
R7731:Hbp1 UTSW 12 31933368 missense possibly damaging 0.93
R8284:Hbp1 UTSW 12 31937626 missense probably damaging 1.00
R8322:Hbp1 UTSW 12 31933388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGGTGAAACACGCAC -3'
(R):5'- ACATGCAACTATTCTTAGCCTAGGC -3'

Sequencing Primer
(F):5'- TGCAGGTGAAACACGCACAAATATG -3'
(R):5'- ACATATTCTGTGGTCATGATACGTG -3'
Posted On2015-05-14