Incidental Mutation 'R4135:Mthfd1'
ID314862
Institutional Source Beutler Lab
Gene Symbol Mthfd1
Ensembl Gene ENSMUSG00000021048
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
SynonymsMthfd, DCS, E430024A07Rik
MMRRC Submission 040995-MU
Accession Numbers

Genbank: NM_138745; MGI: 1342005

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76255298-76319803 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 76282874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021443] [ENSMUST00000220046]
Predicted Effect probably null
Transcript: ENSMUST00000021443
SMART Domains Protein: ENSMUSP00000021443
Gene: ENSMUSG00000021048

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 6 125 1.7e-36 PFAM
Pfam:THF_DHG_CYH_C 128 295 1.1e-67 PFAM
Pfam:FTHFS 317 935 4.1e-259 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220046
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a trifunctional cytoplasmic enzyme. The encoded protein functions as a methylenetetrahydrofolate dehydrogenase, a methenyltetrahydrofolate cyclohydrolase, and a formyltetrahydrofolate synthase. The encoded enzyme functions in de novo synthesis of purines and thymidylate and in regeneration of methionine from homocysteine. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit altered amino acid levels and nucleotide metabolism related to dietary folate and choline concentrations. [provided by MGI curators]
Allele List at MGI

All alleles(57) : Targeted, other(2) Gene trapped(54) Radiation induced(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Mthfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Mthfd1 APN 12 76300439 missense possibly damaging 0.79
IGL01996:Mthfd1 APN 12 76303905 missense probably damaging 1.00
IGL02399:Mthfd1 APN 12 76317632 missense probably damaging 1.00
IGL02529:Mthfd1 APN 12 76303709 missense probably benign 0.02
3-1:Mthfd1 UTSW 12 76314400 critical splice acceptor site probably null
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0732:Mthfd1 UTSW 12 76294174 missense probably damaging 1.00
R1572:Mthfd1 UTSW 12 76270419 nonsense probably null
R1918:Mthfd1 UTSW 12 76314976 missense probably damaging 1.00
R2008:Mthfd1 UTSW 12 76297519 missense probably damaging 1.00
R2280:Mthfd1 UTSW 12 76280492 missense probably benign 0.37
R2857:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2859:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2997:Mthfd1 UTSW 12 76315036 missense probably benign 0.01
R3034:Mthfd1 UTSW 12 76289470 missense probably benign 0.04
R3153:Mthfd1 UTSW 12 76311963 missense probably benign
R3412:Mthfd1 UTSW 12 76303749 splice site probably null
R4245:Mthfd1 UTSW 12 76301273 missense probably damaging 0.99
R4498:Mthfd1 UTSW 12 76314990 missense probably damaging 1.00
R4573:Mthfd1 UTSW 12 76294138 critical splice acceptor site probably null
R5022:Mthfd1 UTSW 12 76294374 missense probably damaging 1.00
R5022:Mthfd1 UTSW 12 76301328 missense probably damaging 1.00
R5037:Mthfd1 UTSW 12 76294140 missense probably damaging 1.00
R5455:Mthfd1 UTSW 12 76301288 missense probably benign 0.20
R5879:Mthfd1 UTSW 12 76294218 missense probably benign 0.00
R5902:Mthfd1 UTSW 12 76291052 missense probably benign 0.01
R6119:Mthfd1 UTSW 12 76303673 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76288911 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76303680 missense probably damaging 1.00
R6931:Mthfd1 UTSW 12 76303698 missense probably benign
R7405:Mthfd1 UTSW 12 76311874 missense probably damaging 0.98
R7658:Mthfd1 UTSW 12 76270435 missense probably damaging 1.00
R8053:Mthfd1 UTSW 12 76280508 missense probably damaging 1.00
X0012:Mthfd1 UTSW 12 76314408 missense possibly damaging 0.75
Z1176:Mthfd1 UTSW 12 76303967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCTTGGCCTAAGCGGAAC -3'
(R):5'- TAGAGAGCTAATGTCCCCACG -3'

Sequencing Primer
(F):5'- CCCCAAGCCCTACTGTAGG -3'
(R):5'- ACACAGGCTGGACGTCTAC -3'
Posted On2015-05-14