Incidental Mutation 'R4135:Gcnt2'
ID314865
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40887807 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 147 (N147K)
Ref Sequence ENSEMBL: ENSMUSP00000070942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069958] [ENSMUST00000110191]
Predicted Effect probably damaging
Transcript: ENSMUST00000069958
AA Change: N147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360
AA Change: N147K

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Bak1 T A 17: 27,021,270 T148S possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGGTCGATTTTCCTTTGGC -3'
(R):5'- TACCTGGTCCTTCCAATGGC -3'

Sequencing Primer
(F):5'- GGCGTATGTCATGGTCATCC -3'
(R):5'- GAGTGAGGTTCTTCCCCTTAAGC -3'
Posted On2015-05-14