Incidental Mutation 'R4135:Bak1'
ID314871
Institutional Source Beutler Lab
Gene Symbol Bak1
Ensembl Gene ENSMUSG00000057789
Gene NameBCL2-antagonist/killer 1
SynonymsN-Bak, Bak
MMRRC Submission 040995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4135 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27019810-27029009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27021270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 148 (T148S)
Ref Sequence ENSEMBL: ENSMUSP00000025034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025034] [ENSMUST00000078691] [ENSMUST00000122106] [ENSMUST00000133257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025034
AA Change: T148S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025034
Gene: ENSMUSG00000057789
AA Change: T148S

DomainStartEndE-ValueType
SCOP:d1f16a_ 15 114 2e-18 SMART
PDB:2M5B|A 18 126 1e-50 PDB
Blast:BCL 33 66 2e-10 BLAST
Blast:BCL 76 126 2e-20 BLAST
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078691
AA Change: Y141F

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077757
Gene: ENSMUSG00000057789
AA Change: Y141F

DomainStartEndE-ValueType
BCL 76 175 2.2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122106
SMART Domains Protein: ENSMUSP00000113880
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Ubiquitin_3 172 260 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133448
SMART Domains Protein: ENSMUSP00000122800
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142141
Predicted Effect probably benign
Transcript: ENSMUST00000143158
SMART Domains Protein: ENSMUSP00000122521
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
PDB:2YV6|A 2 64 2e-29 PDB
SCOP:d1k3ka_ 6 75 4e-14 SMART
Blast:BCL 25 64 6e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151920
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 160,077,522 probably benign Het
9230110F15Rik A G 9: 35,839,428 S33P possibly damaging Het
Cdc25a C A 9: 109,881,517 H157Q possibly damaging Het
Chst5 T C 8: 111,890,184 Y268C probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Ctsr T C 13: 61,161,270 T224A probably benign Het
Cux1 T C 5: 136,307,896 K921E probably damaging Het
Dcaf12l1 T C X: 44,789,453 N156S probably damaging Het
Dennd2d T A 3: 106,482,661 D2E probably benign Het
Dock2 T C 11: 34,714,501 K264E possibly damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Gabrb3 G T 7: 57,591,288 A5S probably benign Het
Gcnt2 T A 13: 40,887,807 N147K probably damaging Het
Gm14139 A T 2: 150,181,868 probably benign Het
Gm6987 T A X: 94,024,610 noncoding transcript Het
Hbp1 A T 12: 31,934,422 L262Q probably damaging Het
Hsd11b2 T C 8: 105,523,166 V303A probably benign Het
Htr5a A G 5: 27,842,692 M82V probably benign Het
Mcc T C 18: 44,724,640 D136G probably benign Het
Mrpl32 C T 13: 14,612,979 V14M probably damaging Het
Msl1 A G 11: 98,796,300 D157G possibly damaging Het
Mthfd1 G A 12: 76,282,874 probably null Het
Nkx6-1 T A 5: 101,659,505 D337V probably damaging Het
Nlrp5 T C 7: 23,418,398 W516R possibly damaging Het
Olfr131 A G 17: 38,082,357 V207A possibly damaging Het
Olfr168 T A 16: 19,530,702 I73F possibly damaging Het
Olfr312 C A 11: 58,831,994 T280K probably damaging Het
Olfr705 A G 7: 106,714,003 L226P probably damaging Het
Olfr723 T C 14: 49,928,815 H243R probably damaging Het
Pold3 T A 7: 100,100,647 R104* probably null Het
Rapsn A T 2: 91,036,817 N155Y probably damaging Het
Rorc C A 3: 94,389,519 Q269K probably damaging Het
Rreb1 A T 13: 37,947,123 N1418Y probably damaging Het
Rusc2 G A 4: 43,425,563 D1223N possibly damaging Het
Sema6d T C 2: 124,664,120 I616T probably damaging Het
Ttc6 T A 12: 57,632,795 probably benign Het
Ugt3a2 A T 15: 9,338,724 Y58F probably damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Vwa5b1 A T 4: 138,594,330 M384K possibly damaging Het
Washc3 G A 10: 88,219,280 E111K probably benign Het
Xirp2 A G 2: 67,525,397 S3501G probably benign Het
Zfp352 C T 4: 90,225,024 T467M probably damaging Het
Zfp729a C A 13: 67,619,806 C768F probably damaging Het
Zfp810 T C 9: 22,279,073 K180E probably damaging Het
Other mutations in Bak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02734:Bak1 APN 17 27020953 missense possibly damaging 0.62
R1056:Bak1 UTSW 17 27021273 missense possibly damaging 0.83
R1806:Bak1 UTSW 17 27021268 nonsense probably null
R4422:Bak1 UTSW 17 27021324 missense probably damaging 1.00
R4664:Bak1 UTSW 17 27022536 missense possibly damaging 0.81
R5182:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R5185:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R6469:Bak1 UTSW 17 27021319 missense probably damaging 1.00
R7155:Bak1 UTSW 17 27022460 missense possibly damaging 0.82
R7999:Bak1 UTSW 17 27021306 missense probably damaging 1.00
R8086:Bak1 UTSW 17 27020937 missense probably benign 0.21
X0066:Bak1 UTSW 17 27022569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATTCAGGGCTGCCACC -3'
(R):5'- GTGTAGCTTCCCATCTGGTG -3'

Sequencing Primer
(F):5'- AACAGGGTGGGTTATAGTGGCC -3'
(R):5'- CCATCTGGTGGTGGAGGG -3'
Posted On2015-05-14