Incidental Mutation 'R4151:Ano10'
ID314910
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4151 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 122261535 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 237 (W237*)
Ref Sequence ENSEMBL: ENSMUSP00000150161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]
Predicted Effect probably null
Transcript: ENSMUST00000042546
AA Change: W237*
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: W237*

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214283
AA Change: W237*
Predicted Effect probably benign
Transcript: ENSMUST00000214409
Predicted Effect probably null
Transcript: ENSMUST00000214507
AA Change: W45*
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Predicted Effect probably null
Transcript: ENSMUST00000216670
AA Change: W237*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Atxn7l1 G A 12: 33,364,482 V506M probably damaging Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cfap45 T A 1: 172,532,221 I96N probably damaging Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Lama4 T A 10: 39,005,428 F71Y probably benign Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Map4k3 T C 17: 80,644,534 K228R probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rfk A C 19: 17,395,308 I65L probably benign Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R1801:Ano10 UTSW 9 122253030 missense probably damaging 1.00
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4027:Ano10 UTSW 9 122252928 splice site probably benign
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R4676:Ano10 UTSW 9 122263787 missense probably damaging 0.98
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6449:Ano10 UTSW 9 122201688 intron probably benign
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7010:Ano10 UTSW 9 122253124 missense probably damaging 1.00
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGCAGTTGTCTCTTGTAGC -3'
(R):5'- CACACATCTGCTTATGCTGTG -3'

Sequencing Primer
(F):5'- CCCGTGACTGAATTGATGCCAAG -3'
(R):5'- CACACATCTGCTTATGCTGTGGTAAG -3'
Posted On2015-05-14