Incidental Mutation 'R4151:Lama4'
ID314911
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Namelaminin, alpha 4
Synonymslaminin [a]4
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4151 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location38965515-39110188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39005428 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 71 (F71Y)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
Predicted Effect probably benign
Transcript: ENSMUST00000019992
AA Change: F71Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: F71Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162211
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Ano10 C T 9: 122,261,535 W237* probably null Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Atxn7l1 G A 12: 33,364,482 V506M probably damaging Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cfap45 T A 1: 172,532,221 I96N probably damaging Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Map4k3 T C 17: 80,644,534 K228R probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rfk A C 19: 17,395,308 I65L probably benign Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
PIT4585001:Lama4 UTSW 10 39074746 missense probably damaging 1.00
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1443:Lama4 UTSW 10 39073643 missense probably damaging 1.00
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1616:Lama4 UTSW 10 39075450 missense probably damaging 1.00
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1768:Lama4 UTSW 10 39103501 missense possibly damaging 0.82
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 intron probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
R7040:Lama4 UTSW 10 39060162 missense possibly damaging 0.69
R7139:Lama4 UTSW 10 39075495 missense probably damaging 1.00
R7188:Lama4 UTSW 10 38965733 start gained probably benign
R7189:Lama4 UTSW 10 38965733 start gained probably benign
R7199:Lama4 UTSW 10 39080540 missense possibly damaging 0.84
R7211:Lama4 UTSW 10 39005495 missense probably damaging 0.98
R7262:Lama4 UTSW 10 39094934 missense probably damaging 1.00
R7274:Lama4 UTSW 10 39092299 missense probably benign 0.00
R7311:Lama4 UTSW 10 39026635 missense probably damaging 1.00
R7391:Lama4 UTSW 10 39087387 critical splice donor site probably null
R7399:Lama4 UTSW 10 39047948 missense probably damaging 0.98
R7426:Lama4 UTSW 10 39045755 missense possibly damaging 0.82
R7472:Lama4 UTSW 10 39087373 missense possibly damaging 0.65
R7635:Lama4 UTSW 10 39092188 missense probably benign
R7775:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7805:Lama4 UTSW 10 39026751 critical splice donor site probably null
R7885:Lama4 UTSW 10 39088844 missense probably benign 0.01
R7895:Lama4 UTSW 10 39088329 missense probably damaging 0.96
R7910:Lama4 UTSW 10 39070009 missense probably damaging 0.99
R7968:Lama4 UTSW 10 39088844 missense probably benign 0.01
R7978:Lama4 UTSW 10 39088329 missense probably damaging 0.96
R7991:Lama4 UTSW 10 39070009 missense probably damaging 0.99
R8059:Lama4 UTSW 10 38966061 missense probably benign 0.00
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Z1177:Lama4 UTSW 10 39005425 missense probably damaging 1.00
Z1177:Lama4 UTSW 10 39005424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCTCTTGTGTAAAGCAGG -3'
(R):5'- AATCAGAAGGCGTTCACACAATATG -3'

Sequencing Primer
(F):5'- AAAGAAGATTGTTGGTGTAATTGTCG -3'
(R):5'- GGCGTTCACACAATATGTTTTATAAG -3'
Posted On2015-05-14