Mutagenetix > Incidental Mutation

Incidental Mutation 'R4151:Vmn2r104'

314921

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

040861-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R4151 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20029885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 708 (I708N)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000168050
AA Change: I708N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I708N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI314180	A	T	4: 58,836,254	S695R	possibly damaging	Het
Ano10	C	T	9: 122,261,535	W237*	probably null	Het
Armc9	C	T	1: 86,164,775	T87M	probably damaging	Het
Astn2	C	T	4: 65,729,320		probably null	Het
Atxn7l1	G	A	12: 33,364,482	V506M	probably damaging	Het
Cenpe	A	G	3: 135,215,153	N36D	probably benign	Het
Cfap45	T	A	1: 172,532,221	I96N	probably damaging	Het
Cyp8b1	A	T	9: 121,916,068	V66D	probably damaging	Het
Dnajb6	C	G	5: 29,756,236	L118V	probably benign	Het
Dpy19l4	A	G	4: 11,309,485	S44P	possibly damaging	Het
Dync2li1	A	G	17: 84,628,335	H20R	probably benign	Het
Eif3g	T	C	9: 20,895,133	D220G	probably benign	Het
Fbxo38	GTGCTGCTGCTGCTGCTGCTGC	GTGCTGCTGCTGCTGCTGC	18: 62,515,328		probably benign	Het
Gata2	T	A	6: 88,199,638	H26Q	probably damaging	Het
Gle1	T	C	2: 29,944,044	I434T	probably damaging	Het
Gm5145	A	G	17: 20,571,098	E246G	probably damaging	Het
Ints10	T	A	8: 68,794,598		probably null	Het
Kdr	G	T	5: 75,957,101	A664E	possibly damaging	Het
Klhl1	A	C	14: 96,518,316	M1R	probably null	Het
Lama4	T	A	10: 39,005,428	F71Y	probably benign	Het
Madd	C	A	2: 91,143,083	R1410L	probably benign	Het
Magi2	T	C	5: 19,227,292	S2P	probably damaging	Het
Map4k3	T	C	17: 80,644,534	K228R	probably damaging	Het
Mrpl43	A	G	19: 45,005,736	L148P	possibly damaging	Het
Msi2	G	C	11: 88,718,044	S16C	probably damaging	Het
Myo1e	G	T	9: 70,297,351	G78*	probably null	Het
Notch2	T	C	3: 98,147,071	L2350S	possibly damaging	Het
Nptn	G	T	9: 58,643,542	S168I	probably benign	Het
Nsmce2	A	G	15: 59,601,365	T244A	probably benign	Het
Olfr1109	C	T	2: 87,093,170	V76I	probably benign	Het
Ostn	T	A	16: 27,321,402	S22T	probably benign	Het
Plekhb2	T	G	1: 34,864,483	F102V	probably benign	Het
Prkdc	A	G	16: 15,816,773	D3594G	probably benign	Het
Psmd6	G	C	14: 14,120,157	L61V	probably benign	Het
Rbm33	C	T	5: 28,387,940	P573S	probably damaging	Het
Rfk	A	C	19: 17,395,308	I65L	probably benign	Het
Rnf141	A	T	7: 110,837,199	D7E	probably benign	Het
Shank2	A	T	7: 144,054,828	K153M	probably damaging	Het
Slc30a2	A	T	4: 134,344,048	I31F	probably benign	Het
Slco3a1	G	T	7: 74,359,838	A243E	probably damaging	Het
Stab2	G	A	10: 87,002,983	T73I	probably benign	Het
Sufu	G	A	19: 46,449,972		probably null	Het
Sync	C	T	4: 129,293,726	Q184*	probably null	Het
Tnfrsf25	G	T	4: 152,119,801	A376S	probably damaging	Het
Tnpo1	A	T	13: 98,852,899	I765N	probably damaging	Het
Ube2d2b	A	T	5: 107,830,881	K133*	probably null	Het
Ulk3	C	T	9: 57,592,367	S217L	possibly damaging	Het
Upf2	C	A	2: 5,961,705	Q379K	unknown	Het
Vegfc	T	A	8: 54,077,789	L4Q	unknown	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9303:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9414:Vmn2r104	UTSW	17	20029988	missense	probably damaging	0.99
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGTATAACTCCCAAGGGCC -3'
(R):5'- TGTCAAGGCCAATAATCGGACTC -3'

Sequencing Primer
(F):5'- GGCCAAGAAACAGAGGTATCCC -3'
(R):5'- GGCCAATAATCGGACTCTAAGTTAC -3'

Posted On

2015-05-14