Incidental Mutation 'R4151:Map4k3'
ID314924
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
MMRRC Submission 040861-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4151 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80644534 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 228 (K228R)
Ref Sequence ENSEMBL: ENSMUSP00000025089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect probably damaging
Transcript: ENSMUST00000025089
AA Change: K228R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: K228R

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112389
AA Change: K228R

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: K228R

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,836,254 S695R possibly damaging Het
Ano10 C T 9: 122,261,535 W237* probably null Het
Armc9 C T 1: 86,164,775 T87M probably damaging Het
Astn2 C T 4: 65,729,320 probably null Het
Atxn7l1 G A 12: 33,364,482 V506M probably damaging Het
Cenpe A G 3: 135,215,153 N36D probably benign Het
Cfap45 T A 1: 172,532,221 I96N probably damaging Het
Cyp8b1 A T 9: 121,916,068 V66D probably damaging Het
Dnajb6 C G 5: 29,756,236 L118V probably benign Het
Dpy19l4 A G 4: 11,309,485 S44P possibly damaging Het
Dync2li1 A G 17: 84,628,335 H20R probably benign Het
Eif3g T C 9: 20,895,133 D220G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Gata2 T A 6: 88,199,638 H26Q probably damaging Het
Gle1 T C 2: 29,944,044 I434T probably damaging Het
Gm5145 A G 17: 20,571,098 E246G probably damaging Het
Ints10 T A 8: 68,794,598 probably null Het
Kdr G T 5: 75,957,101 A664E possibly damaging Het
Klhl1 A C 14: 96,518,316 M1R probably null Het
Lama4 T A 10: 39,005,428 F71Y probably benign Het
Madd C A 2: 91,143,083 R1410L probably benign Het
Magi2 T C 5: 19,227,292 S2P probably damaging Het
Mrpl43 A G 19: 45,005,736 L148P possibly damaging Het
Msi2 G C 11: 88,718,044 S16C probably damaging Het
Myo1e G T 9: 70,297,351 G78* probably null Het
Notch2 T C 3: 98,147,071 L2350S possibly damaging Het
Nptn G T 9: 58,643,542 S168I probably benign Het
Nsmce2 A G 15: 59,601,365 T244A probably benign Het
Olfr1109 C T 2: 87,093,170 V76I probably benign Het
Ostn T A 16: 27,321,402 S22T probably benign Het
Plekhb2 T G 1: 34,864,483 F102V probably benign Het
Prkdc A G 16: 15,816,773 D3594G probably benign Het
Psmd6 G C 14: 14,120,157 L61V probably benign Het
Rbm33 C T 5: 28,387,940 P573S probably damaging Het
Rfk A C 19: 17,395,308 I65L probably benign Het
Rnf141 A T 7: 110,837,199 D7E probably benign Het
Shank2 A T 7: 144,054,828 K153M probably damaging Het
Slc30a2 A T 4: 134,344,048 I31F probably benign Het
Slco3a1 G T 7: 74,359,838 A243E probably damaging Het
Stab2 G A 10: 87,002,983 T73I probably benign Het
Sufu G A 19: 46,449,972 probably null Het
Sync C T 4: 129,293,726 Q184* probably null Het
Tnfrsf25 G T 4: 152,119,801 A376S probably damaging Het
Tnpo1 A T 13: 98,852,899 I765N probably damaging Het
Ube2d2b A T 5: 107,830,881 K133* probably null Het
Ulk3 C T 9: 57,592,367 S217L possibly damaging Het
Upf2 C A 2: 5,961,705 Q379K unknown Het
Vegfc T A 8: 54,077,789 L4Q unknown Het
Vmn2r104 A T 17: 20,029,885 I708N probably damaging Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0084:Map4k3 UTSW 17 80655914 missense possibly damaging 0.91
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R2224:Map4k3 UTSW 17 80630454 missense probably benign 0.00
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R4970:Map4k3 UTSW 17 80653903 missense probably benign 0.00
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5459:Map4k3 UTSW 17 80609787 missense probably damaging 1.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7680:Map4k3 UTSW 17 80581876 missense probably benign 0.02
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAGCTTTTCTGCATTGGGTC -3'
(R):5'- TTGACCTTCACCCGATGAGG -3'

Sequencing Primer
(F):5'- AGCTTTTCTGCATTGGGTCTTTTC -3'
(R):5'- TTCACCCGATGAGGTCAGTG -3'
Posted On2015-05-14