Incidental Mutation 'R4152:Zc3h15'
ID314936
Institutional Source Beutler Lab
Gene Symbol Zc3h15
Ensembl Gene ENSMUSG00000027091
Gene Namezinc finger CCCH-type containing 15
Synonyms2610312B22Rik, FM22, Ierepo4, 1700006A17Rik, 1810012H02Rik
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83644435-83664622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83658569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 161 (V161A)
Ref Sequence ENSEMBL: ENSMUSP00000080301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081591]
Predicted Effect probably benign
Transcript: ENSMUST00000081591
AA Change: V161A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080301
Gene: ENSMUSG00000027091
AA Change: V161A

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
coiled coil region 60 86 N/A INTRINSIC
ZnF_C3H1 99 125 7.84e-8 SMART
ZnF_C3H1 175 211 3.81e0 SMART
Pfam:DFRP_C 229 336 4.2e-23 PFAM
low complexity region 410 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145099
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Other mutations in Zc3h15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Zc3h15 APN 2 83660173 missense probably damaging 1.00
IGL01688:Zc3h15 APN 2 83662192 missense probably damaging 0.99
IGL01951:Zc3h15 APN 2 83661485 missense probably damaging 1.00
IGL02514:Zc3h15 APN 2 83653381 missense probably damaging 1.00
IGL02852:Zc3h15 APN 2 83644671 missense possibly damaging 0.85
IGL03075:Zc3h15 APN 2 83662191 missense possibly damaging 0.95
IGL03055:Zc3h15 UTSW 2 83661171 missense possibly damaging 0.90
R0117:Zc3h15 UTSW 2 83658083 missense possibly damaging 0.51
R0465:Zc3h15 UTSW 2 83663815 splice site probably benign
R1711:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R1861:Zc3h15 UTSW 2 83663990 missense unknown
R2258:Zc3h15 UTSW 2 83657016 missense probably benign 0.00
R2325:Zc3h15 UTSW 2 83653439 missense probably damaging 1.00
R4154:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4420:Zc3h15 UTSW 2 83658012 missense probably damaging 0.97
R5384:Zc3h15 UTSW 2 83660230 missense possibly damaging 0.55
R6341:Zc3h15 UTSW 2 83661223 missense probably benign 0.11
R6544:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R6923:Zc3h15 UTSW 2 83657056 missense possibly damaging 0.68
R7770:Zc3h15 UTSW 2 83658132 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTTATATAAGCTGCCCTGGGAG -3'
(R):5'- AAGCAGGGCGTATTGTAGC -3'

Sequencing Primer
(F):5'- CCCTGGGAGCTTGGATTGATAG -3'
(R):5'- AGCAGGGCGTATTGTAGCTTATATTG -3'
Posted On2015-05-14