Incidental Mutation 'R4152:Tlr6'
ID314940
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64953212 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 784 (F784C)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably damaging
Transcript: ENSMUST00000062315
AA Change: F784C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: F784C

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Meta Mutation Damage Score 0.9224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCAACAGTGGGCAAGTCC -3'
(R):5'- AGTGAGTGGTGCCATTATGAAC -3'

Sequencing Primer
(F):5'- CTCAACAGTGGGCAAGTCCATTAATG -3'
(R):5'- GGTGCCATTATGAACTCTATTTTGC -3'
Posted On2015-05-14