Incidental Mutation 'R4152:Ap3b2'
ID314949
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81478017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: I137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I137T

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119121
SMART Domains Protein: ENSMUSP00000114032
Gene: ENSMUSG00000062444

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 122 5.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably damaging
Transcript: ENSMUST00000152355
AA Change: I137T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATTCCAGACGAGAAGCAGC -3'
(R):5'- AAGCTAGCCCTTGTCAGGAG -3'

Sequencing Primer
(F):5'- CCTGCAAAACCGTGGTAAGGTC -3'
(R):5'- CTAGCCCTTGTCAGGAGGTAGG -3'
Posted On2015-05-14