Incidental Mutation 'R4152:Rsad1'
ID314963
Institutional Source Beutler Lab
Gene Symbol Rsad1
Ensembl Gene ENSMUSG00000039096
Gene Nameradical S-adenosyl methionine domain containing 1
Synonyms
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94539798-94549255 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 94548623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040487]
Predicted Effect probably benign
Transcript: ENSMUST00000040487
SMART Domains Protein: ENSMUSP00000037361
Gene: ENSMUSG00000039096

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Elp3 39 259 6.54e-40 SMART
Pfam:HemN_C 346 414 7.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148888
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Rsad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Rsad1 APN 11 94543640 missense possibly damaging 0.65
IGL01915:Rsad1 APN 11 94548977 splice site probably null
R0271:Rsad1 UTSW 11 94548464 splice site probably benign
R0619:Rsad1 UTSW 11 94542639 missense probably damaging 1.00
R1147:Rsad1 UTSW 11 94544140 missense probably damaging 1.00
R1147:Rsad1 UTSW 11 94544140 missense probably damaging 1.00
R2069:Rsad1 UTSW 11 94549125 start gained probably benign
R3831:Rsad1 UTSW 11 94543304 missense probably benign 0.45
R3833:Rsad1 UTSW 11 94543304 missense probably benign 0.45
R4467:Rsad1 UTSW 11 94544530 missense probably benign
R4672:Rsad1 UTSW 11 94543618 missense probably damaging 0.99
R5452:Rsad1 UTSW 11 94543689 missense probably damaging 0.98
R6190:Rsad1 UTSW 11 94548236 missense probably damaging 1.00
R6608:Rsad1 UTSW 11 94542609 missense probably damaging 1.00
R6749:Rsad1 UTSW 11 94543340 missense probably damaging 1.00
X0024:Rsad1 UTSW 11 94548981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTCCCCAGTACTGACCTCTG -3'
(R):5'- ACCGGAATAAGTGTTTGGCC -3'

Sequencing Primer
(F):5'- AGTACTGACCTCTGCACCC -3'
(R):5'- AACCTCAAGTCTGGTGCTTACTAG -3'
Posted On2015-05-14