Mutagenetix > Incidental Mutations

Incidental Mutation 'R4152:Akap6'

314964

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

040996-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.737) question?

Stock #

R4152 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53140407 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1535 (S1535R)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

Predicted Effect

probably benign
Transcript: ENSMUST00000095737
AA Change: S1535R

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: S1535R

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,156,897	H2036Q	possibly damaging	Het
Acaca	T	G	11: 84,292,926	M31R	possibly damaging	Het
Ap3b2	A	G	7: 81,478,017	I137T	probably damaging	Het
Cdc16	A	G	8: 13,762,857	S36G	probably damaging	Het
Clcn4	T	C	7: 7,294,834	N67D	probably benign	Het
Col4a1	T	C	8: 11,217,227		probably null	Het
Crem	G	T	18: 3,288,055	N179K	probably damaging	Het
Fam78b	T	C	1: 167,078,800	M176T	probably benign	Het
Gcn1l1	A	G	5: 115,613,354		probably null	Het
Gm6483	T	C	8: 19,687,910		noncoding transcript	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klk1b16	T	C	7: 44,140,549	F81S	probably benign	Het
Lpgat1	C	A	1: 191,719,488	Y36*	probably null	Het
Mavs	A	G	2: 131,246,608	D444G	probably benign	Het
Ndst3	T	C	3: 123,672,227	Y32C	probably damaging	Het
Nemp2	A	G	1: 52,641,051	S145G	probably benign	Het
Olfr690	T	C	7: 105,329,385	N269S	probably damaging	Het
Olfr835	T	A	9: 19,035,520	Y132*	probably null	Het
Olfr965	A	C	9: 39,720,000	M258L	probably benign	Het
Pds5a	A	T	5: 65,666,171	C92*	probably null	Het
Pgk2	A	G	17: 40,208,258	V93A	probably damaging	Het
Phf3	C	T	1: 30,831,458	V116I	probably benign	Het
Prl8a2	T	C	13: 27,351,002	Y86H	possibly damaging	Het
Rab4b	T	C	7: 27,176,126		probably benign	Het
Rsad1	T	C	11: 94,548,623		probably benign	Het
Sim1	G	A	10: 50,983,854	C604Y	probably damaging	Het
Slc5a3	T	A	16: 92,077,808	L251*	probably null	Het
Slit3	A	G	11: 35,698,320	N1234S	probably damaging	Het
Sntg1	A	T	1: 8,583,345		probably null	Het
Snx31	T	C	15: 36,525,639	N305D	probably benign	Het
St14	T	C	9: 31,090,506	I768V	probably benign	Het
Tep1	G	A	14: 50,837,594	H1755Y	possibly damaging	Het
Tlr6	A	C	5: 64,953,212	F784C	probably damaging	Het
Tmem132a	A	G	19: 10,859,063	V701A	probably benign	Het
Tspan15	A	T	10: 62,189,842	M197K	possibly damaging	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vegfb	T	C	19: 6,986,078	Y106C	probably damaging	Het
Vmn2r100	AAAACAGGAGTATTGATTGGAAAC	AAAAC	17: 19,523,419		probably null	Het
Vmn2r18	T	A	5: 151,562,265	Q588L	probably damaging	Het
Vmn2r66	T	C	7: 85,005,592	D503G	probably benign	Het
Zc3h15	T	C	2: 83,658,569	V161A	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCACTGATTGTTTGGGAGACG -3'
(R):5'- AAGAAGTGCTTCGCTGGAGG -3'

Sequencing Primer
(F):5'- TATGACTACTCGTACCTCCAAGG -3'
(R):5'- GGCTGTCACTGCCATTTTTAAAG -3'

Posted On

2015-05-14