Incidental Mutation 'R4152:Snx31'
ID314967
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Namesorting nexin 31
Synonyms4631426E05Rik
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location36504062-36555573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36525639 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 305 (N305D)
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000161202]
Predicted Effect probably benign
Transcript: ENSMUST00000013755
AA Change: N305D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611
AA Change: N305D

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161202
AA Change: N305D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611
AA Change: N305D

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36545616 critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36517672 missense probably damaging 1.00
IGL02514:Snx31 APN 15 36525582 missense probably damaging 1.00
IGL03069:Snx31 APN 15 36525603 nonsense probably null
IGL03182:Snx31 APN 15 36525687 missense probably benign 0.00
R0755:Snx31 UTSW 15 36534430 missense probably damaging 0.99
R1005:Snx31 UTSW 15 36517691 splice site probably benign
R1463:Snx31 UTSW 15 36539298 missense probably null 1.00
R1513:Snx31 UTSW 15 36545600 missense probably damaging 0.99
R2030:Snx31 UTSW 15 36525702 missense probably benign 0.31
R3404:Snx31 UTSW 15 36525653 missense probably benign 0.00
R3720:Snx31 UTSW 15 36523558 critical splice acceptor site probably null
R4474:Snx31 UTSW 15 36546111 intron probably benign
R4729:Snx31 UTSW 15 36523552 missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36539367 missense probably damaging 0.96
R5010:Snx31 UTSW 15 36555324 missense probably damaging 1.00
R5375:Snx31 UTSW 15 36525584 missense probably damaging 0.99
R5893:Snx31 UTSW 15 36523455 missense probably damaging 0.98
R5970:Snx31 UTSW 15 36523488 nonsense probably null
R6211:Snx31 UTSW 15 36546885 missense probably damaging 0.98
R7198:Snx31 UTSW 15 36555310 missense probably benign 0.04
R7293:Snx31 UTSW 15 36523450 missense probably damaging 0.97
R7329:Snx31 UTSW 15 36555476 missense probably benign 0.00
R7741:Snx31 UTSW 15 36523441 critical splice donor site probably null
R8057:Snx31 UTSW 15 36523460 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGTGACATCCAAAGTGAC -3'
(R):5'- CGCTGTGAGCTCCATAAATGTG -3'

Sequencing Primer
(F):5'- AACTTGCTCATAGGCTAGGC -3'
(R):5'- GCTGTGAGCTCCATAAATGTGAAAAC -3'
Posted On2015-05-14