Incidental Mutation 'R4152:Vegfb'
ID314974
Institutional Source Beutler Lab
Gene Symbol Vegfb
Ensembl Gene ENSMUSG00000024962
Gene Namevascular endothelial growth factor B
SynonymsVrf, VEGF-B
MMRRC Submission 040996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4152 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6982473-6987651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6986078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 106 (Y106C)
Ref Sequence ENSEMBL: ENSMUSP00000025914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025914] [ENSMUST00000025915] [ENSMUST00000130048] [ENSMUST00000179118]
Predicted Effect probably damaging
Transcript: ENSMUST00000025914
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025914
Gene: ENSMUSG00000024962
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
low complexity region 182 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025915
SMART Domains Protein: ENSMUSP00000025915
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 160 179 N/A INTRINSIC
low complexity region 205 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130048
AA Change: Y106C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120860
Gene: ENSMUSG00000024962
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
Pfam:VEGF_C 134 188 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147924
Predicted Effect probably benign
Transcript: ENSMUST00000179118
SMART Domains Protein: ENSMUSP00000136062
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 159 178 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Meta Mutation Damage Score 0.2840 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one or more disruptions in this gene display defective cardiac morphology and physiology, sensitivity to induced neurodegeneration, increased weight and brown adipose whitening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,897 H2036Q possibly damaging Het
Acaca T G 11: 84,292,926 M31R possibly damaging Het
Akap6 A C 12: 53,140,407 S1535R probably benign Het
Ap3b2 A G 7: 81,478,017 I137T probably damaging Het
Cdc16 A G 8: 13,762,857 S36G probably damaging Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Col4a1 T C 8: 11,217,227 probably null Het
Crem G T 18: 3,288,055 N179K probably damaging Het
Fam78b T C 1: 167,078,800 M176T probably benign Het
Gcn1l1 A G 5: 115,613,354 probably null Het
Gm6483 T C 8: 19,687,910 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klk1b16 T C 7: 44,140,549 F81S probably benign Het
Lpgat1 C A 1: 191,719,488 Y36* probably null Het
Mavs A G 2: 131,246,608 D444G probably benign Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nemp2 A G 1: 52,641,051 S145G probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr835 T A 9: 19,035,520 Y132* probably null Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pds5a A T 5: 65,666,171 C92* probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Phf3 C T 1: 30,831,458 V116I probably benign Het
Prl8a2 T C 13: 27,351,002 Y86H possibly damaging Het
Rab4b T C 7: 27,176,126 probably benign Het
Rsad1 T C 11: 94,548,623 probably benign Het
Sim1 G A 10: 50,983,854 C604Y probably damaging Het
Slc5a3 T A 16: 92,077,808 L251* probably null Het
Slit3 A G 11: 35,698,320 N1234S probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Snx31 T C 15: 36,525,639 N305D probably benign Het
St14 T C 9: 31,090,506 I768V probably benign Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Tlr6 A C 5: 64,953,212 F784C probably damaging Het
Tmem132a A G 19: 10,859,063 V701A probably benign Het
Tspan15 A T 10: 62,189,842 M197K possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r18 T A 5: 151,562,265 Q588L probably damaging Het
Vmn2r66 T C 7: 85,005,592 D503G probably benign Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Vegfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Vegfb APN 19 6986478 missense probably damaging 1.00
IGL02365:Vegfb APN 19 6985487 missense probably benign 0.19
IGL02431:Vegfb APN 19 6986018 splice site probably null
R2040:Vegfb UTSW 19 6986039 missense possibly damaging 0.93
R2312:Vegfb UTSW 19 6985427 missense possibly damaging 0.63
R3777:Vegfb UTSW 19 6987399 unclassified probably benign
R4154:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R5635:Vegfb UTSW 19 6982846 makesense probably null
R7804:Vegfb UTSW 19 6986339 missense probably damaging 1.00
R8348:Vegfb UTSW 19 6985488 missense probably benign 0.01
R8673:Vegfb UTSW 19 6985444 missense unknown
Predicted Primers PCR Primer
(F):5'- GATCCATGCCTACTACTTCTGG -3'
(R):5'- AAGTCCGAATGCAGGTACCAG -3'

Sequencing Primer
(F):5'- GGCTCTACTCTCAGTCACCTGG -3'
(R):5'- ATGCAGGTACCAGGGCCTATG -3'
Posted On2015-05-14