Incidental Mutation 'R4153:Thumpd1'
Institutional Source Beutler Lab
Gene Symbol Thumpd1
Ensembl Gene ENSMUSG00000030942
Gene NameTHUMP domain containing 1
MMRRC Submission 040997-MU
Accession Numbers

Genbank: NM_145585; MGI: 2444479

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosomal Location119715093-119720798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119720593 bp
Amino Acid Change Cysteine to Tyrosine at position 50 (C50Y)
Ref Sequence ENSEMBL: ENSMUSP00000033236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033236]
Predicted Effect probably damaging
Transcript: ENSMUST00000033236
AA Change: C50Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033236
Gene: ENSMUSG00000030942
AA Change: C50Y

THUMP 161 254 4.5e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209175
Meta Mutation Damage Score 0.9338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Thumpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL01151:Thumpd1 APN 7 119718195 missense probably damaging 0.97
IGL01327:Thumpd1 APN 7 119720702 missense probably benign 0.12
IGL02140:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL02945:Thumpd1 APN 7 119716747 missense possibly damaging 0.48
F6893:Thumpd1 UTSW 7 119720576 nonsense probably null
R4934:Thumpd1 UTSW 7 119716779 missense probably benign 0.00
R5475:Thumpd1 UTSW 7 119720720 missense probably benign
R5631:Thumpd1 UTSW 7 119720602 missense probably damaging 1.00
R6123:Thumpd1 UTSW 7 119717009 missense probably damaging 1.00
R6292:Thumpd1 UTSW 7 119720674 missense probably benign 0.38
R6351:Thumpd1 UTSW 7 119720605 missense possibly damaging 0.94
R7565:Thumpd1 UTSW 7 119716862 nonsense probably null
R8139:Thumpd1 UTSW 7 119720585 missense possibly damaging 0.82
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14