Incidental Mutation 'R4153:Gopc'
ID314999
Institutional Source Beutler Lab
Gene Symbol Gopc
Ensembl Gene ENSMUSG00000019861
Gene Namegolgi associated PDZ and coiled-coil motif containing
Synonyms2210402P09Rik, GOPC1
MMRRC Submission 040997-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R4153 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52335850-52382124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52349143 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 277 (I277V)
Ref Sequence ENSEMBL: ENSMUSP00000151773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020008] [ENSMUST00000105475] [ENSMUST00000217753] [ENSMUST00000217995]
Predicted Effect probably damaging
Transcript: ENSMUST00000020008
AA Change: I329V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020008
Gene: ENSMUSG00000019861
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
coiled coil region 85 125 N/A INTRINSIC
Blast:PDZ 192 232 5e-10 BLAST
PDZ 290 364 5.41e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105475
AA Change: I337V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101115
Gene: ENSMUSG00000019861
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
coiled coil region 85 125 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
Blast:PDZ 200 240 5e-10 BLAST
PDZ 298 372 5.41e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217710
Predicted Effect probably damaging
Transcript: ENSMUST00000217753
AA Change: I277V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220099
Meta Mutation Damage Score 0.4021 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein with a PDZ domain. The PDZ domain is globular and proteins which contain them bind other proteins through short motifs near the C-termini. Mice which are deficient in the orthologous protein have globozoospermia and are infertile. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele show male sterility with globozoospermia characterized by a complete lack of acrosomes due to failure of vesicle transport from the Golgi apparatus, a malformed sperm nucleus, and abnormal mitochondrial arrangement in the mitochondrial sheath of mutant spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Vps13b T A 15: 35,792,027 probably null Het
Other mutations in Gopc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Gopc APN 10 52349230 missense probably damaging 0.98
IGL01146:Gopc APN 10 52358867 missense probably benign 0.31
R0281:Gopc UTSW 10 52350678 missense probably damaging 0.98
R0798:Gopc UTSW 10 52358811 missense probably damaging 0.97
R2238:Gopc UTSW 10 52353403 missense probably damaging 1.00
R2255:Gopc UTSW 10 52349085 missense probably damaging 0.99
R2507:Gopc UTSW 10 52353326 critical splice donor site probably null
R5484:Gopc UTSW 10 52358846 missense probably damaging 1.00
R5936:Gopc UTSW 10 52346199 missense probably damaging 1.00
R7385:Gopc UTSW 10 52349232 missense probably damaging 1.00
R7806:Gopc UTSW 10 52353429 missense probably damaging 0.98
X0019:Gopc UTSW 10 52339741 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGAGCTTAGGAGACTGCTGC -3'
(R):5'- TTCACCCCATTCTTACAGAGAC -3'

Sequencing Primer
(F):5'- TTAGGAGACTGCTGCCCAGAG -3'
(R):5'- GATGTTCTATTGCCAGGG -3'
Posted On2015-05-14