Incidental Mutation 'R4153:Vps13b'
ID 315010
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 040997-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4153 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 35371160-35931229 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 35792027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048646
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646

Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228829
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,193,173 V47A probably benign Het
4932414N04Rik A T 2: 68,668,597 probably benign Het
Acat2 T A 17: 12,952,266 H159L possibly damaging Het
Acsl5 A G 19: 55,281,463 E253G probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ebf2 T G 14: 67,235,223 V30G probably damaging Het
Erlin1 T A 19: 44,067,617 T60S probably benign Het
Fanca A G 8: 123,304,878 V358A possibly damaging Het
Fastkd3 T C 13: 68,590,138 F602S probably damaging Het
Fras1 C A 5: 96,776,735 N3678K probably benign Het
Gm5346 T A 8: 43,626,527 Y220F probably benign Het
Gopc T C 10: 52,349,143 I277V probably damaging Het
Gpd2 A G 2: 57,355,771 T438A probably damaging Het
Gzma T C 13: 113,096,268 K97E possibly damaging Het
Gzmn T A 14: 56,167,842 T62S probably damaging Het
Hip1 T C 5: 135,412,706 E570G probably damaging Het
Hs3st6 T C 17: 24,758,365 V273A possibly damaging Het
Jarid2 C A 13: 44,910,426 S873R probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mast2 T C 4: 116,315,963 N548S possibly damaging Het
Mthfr G T 4: 148,051,475 R335L probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nwd1 T C 8: 72,681,936 L808P probably damaging Het
Olfr681 A T 7: 105,122,309 H284L probably damaging Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Olfr965 A C 9: 39,720,000 M258L probably benign Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pigk G A 3: 152,740,129 V126I probably damaging Het
Plcl2 A T 17: 50,606,361 K133* probably null Het
Pofut2 A G 10: 77,268,666 K426E probably benign Het
Rbpj T A 5: 53,649,447 H230Q probably damaging Het
Rnf213 A G 11: 119,409,482 K269E probably benign Het
Shh A T 5: 28,457,949 I407N probably damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Svep1 A T 4: 58,089,426 F1661Y possibly damaging Het
Tep1 G A 14: 50,837,594 H1755Y possibly damaging Het
Thrap3 A C 4: 126,173,442 probably null Het
Thumpd1 C T 7: 119,720,593 C50Y probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnrc18 T C 5: 142,765,992 D1368G possibly damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Ugt1a6a A G 1: 88,138,471 probably null Het
Uty A G Y: 1,158,327 V572A possibly damaging Het
Vmn1r171 A G 7: 23,632,652 K89E probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Vmn2r106 A G 17: 20,267,818 L773P probably damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
R7400:Vps13b UTSW 15 35378900 missense probably damaging 1.00
R7414:Vps13b UTSW 15 35910827 missense probably damaging 1.00
R7497:Vps13b UTSW 15 35876697 missense probably benign 0.38
R7500:Vps13b UTSW 15 35910524 missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35576439 missense probably damaging 0.98
R7605:Vps13b UTSW 15 35770646 missense probably damaging 0.97
R7849:Vps13b UTSW 15 35423232 missense probably damaging 0.99
R7984:Vps13b UTSW 15 35879913 missense probably benign
R8094:Vps13b UTSW 15 35668906 critical splice donor site probably null
R8097:Vps13b UTSW 15 35709346 missense probably benign 0.38
R8131:Vps13b UTSW 15 35372109 critical splice donor site probably null
R8139:Vps13b UTSW 15 35607272 nonsense probably null
R8174:Vps13b UTSW 15 35709310 nonsense probably null
R8225:Vps13b UTSW 15 35794382 missense probably damaging 0.99
R8239:Vps13b UTSW 15 35597404 missense probably damaging 1.00
R8244:Vps13b UTSW 15 35917203 missense probably damaging 1.00
R8303:Vps13b UTSW 15 35639917 missense probably damaging 1.00
R8311:Vps13b UTSW 15 35886954 missense probably benign 0.37
R8443:Vps13b UTSW 15 35455100 missense probably benign
R8494:Vps13b UTSW 15 35422448 missense probably damaging 0.99
R8499:Vps13b UTSW 15 35841320 missense probably damaging 1.00
R8506:Vps13b UTSW 15 35446745 missense probably benign 0.31
R8559:Vps13b UTSW 15 35876642 missense probably damaging 1.00
R8686:Vps13b UTSW 15 35925389 missense probably damaging 0.99
R8782:Vps13b UTSW 15 35422337 missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35472066 critical splice donor site probably benign
R8824:Vps13b UTSW 15 35533299 missense probably damaging 0.99
R9024:Vps13b UTSW 15 35923324 missense probably damaging 0.97
R9038:Vps13b UTSW 15 35875785 missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35422391 missense probably damaging 1.00
R9091:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9129:Vps13b UTSW 15 35448647 missense probably damaging 1.00
R9214:Vps13b UTSW 15 35623746 missense probably damaging 0.99
R9237:Vps13b UTSW 15 35841333 missense probably damaging 1.00
R9256:Vps13b UTSW 15 35623779 missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9279:Vps13b UTSW 15 35572144 missense probably damaging 0.97
R9291:Vps13b UTSW 15 35846913 missense probably damaging 1.00
R9342:Vps13b UTSW 15 35455054 missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35876419 missense probably damaging 1.00
R9488:Vps13b UTSW 15 35447734 missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35841311 missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35623628 missense probably benign 0.00
R9674:Vps13b UTSW 15 35607234 missense probably damaging 0.98
R9696:Vps13b UTSW 15 35674887 missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35910257 missense probably damaging 1.00
R9797:Vps13b UTSW 15 35674876 missense probably damaging 1.00
RF020:Vps13b UTSW 15 35925406 missense probably null 1.00
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Z1177:Vps13b UTSW 15 35668885 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-05-14