Incidental Mutation 'R4154:Sntg1'
ID315023
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Namesyntrophin, gamma 1
SynonymsSYN4, G1SYN
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location8361475-9299878 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8583345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000115488] [ENSMUST00000115488] [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000132064] [ENSMUST00000132064] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000140302] [ENSMUST00000191683] [ENSMUST00000191683]
Predicted Effect probably null
Transcript: ENSMUST00000115488
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115488
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115488
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115488
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132064
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132064
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132064
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132064
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140295
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140295
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191683
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191683
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8595410 critical splice donor site probably null
IGL01536:Sntg1 APN 1 8583200 splice site probably null
IGL01558:Sntg1 APN 1 8463388 splice site probably benign
IGL01649:Sntg1 APN 1 8681969 splice site probably benign
IGL02230:Sntg1 APN 1 8681971 critical splice donor site probably null
IGL02252:Sntg1 APN 1 8414228 missense probably benign 0.00
IGL02804:Sntg1 APN 1 8803958 utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8445104 missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8463414 missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8463462 missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8679062 splice site probably benign
R0379:Sntg1 UTSW 1 8782824 missense probably damaging 1.00
R0551:Sntg1 UTSW 1 8554736 missense possibly damaging 0.73
R1081:Sntg1 UTSW 1 8445119 missense possibly damaging 0.92
R1645:Sntg1 UTSW 1 8803931 missense probably benign 0.06
R2089:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R3951:Sntg1 UTSW 1 8782901 splice site probably benign
R4152:Sntg1 UTSW 1 8583345 splice site probably null
R4153:Sntg1 UTSW 1 8583345 splice site probably null
R4847:Sntg1 UTSW 1 8595482 missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8363594 missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8782798 missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8363439 utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8595533 missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8624784 missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8414271 missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8463443 missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8414270 missense probably benign 0.00
R6075:Sntg1 UTSW 1 8679114 makesense probably null
R6266:Sntg1 UTSW 1 8554729 missense possibly damaging 0.56
R6313:Sntg1 UTSW 1 8445024 splice site probably null
R6345:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8363528 utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8445050 missense probably benign 0.16
R7112:Sntg1 UTSW 1 8448065 missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8682019 missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8448065 missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8445025 critical splice donor site probably null
R7892:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R8009:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
X0026:Sntg1 UTSW 1 8414247 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATGCTGAAAGACTTGCTGGTTAG -3'
(R):5'- CTCAAAGGTTGTCCATATTTAGCTG -3'

Sequencing Primer
(F):5'- AGACTTGCTGGTTAGATATTTATTCC -3'
(R):5'- GCTGAATATAAGAATGTCATCTCAT -3'
Posted On2015-05-14