Incidental Mutation 'R4154:Tmem131'
ID315024
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Nametransmembrane protein 131
Synonyms2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36792191-36943666 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 36808793 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000194563]
Predicted Effect probably benign
Transcript: ENSMUST00000027290
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191381
Predicted Effect probably benign
Transcript: ENSMUST00000194563
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2879:Tmem131 UTSW 1 36841707 missense possibly damaging 0.76
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3821:Tmem131 UTSW 1 36808396 missense probably damaging 0.99
R3961:Tmem131 UTSW 1 36818950 missense probably damaging 1.00
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCAGAGCCACAACCTTC -3'
(R):5'- ATCAAGGAGCCTGTGGTAACC -3'

Sequencing Primer
(F):5'- GAGCCACAACCTTCTACAGTTTG -3'
(R):5'- GAGCCTGTGGTAACCAAATATTATTC -3'
Posted On2015-05-14