Incidental Mutation 'R4154:Zc3h15'
Institutional Source Beutler Lab
Gene Symbol Zc3h15
Ensembl Gene ENSMUSG00000027091
Gene Namezinc finger CCCH-type containing 15
Synonyms2610312B22Rik, FM22, Ierepo4, 1700006A17Rik, 1810012H02Rik
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosomal Location83644435-83664622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83658569 bp
Amino Acid Change Valine to Alanine at position 161 (V161A)
Ref Sequence ENSEMBL: ENSMUSP00000080301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081591]
Predicted Effect probably benign
Transcript: ENSMUST00000081591
AA Change: V161A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080301
Gene: ENSMUSG00000027091
AA Change: V161A

low complexity region 4 27 N/A INTRINSIC
coiled coil region 60 86 N/A INTRINSIC
ZnF_C3H1 99 125 7.84e-8 SMART
ZnF_C3H1 175 211 3.81e0 SMART
Pfam:DFRP_C 229 336 4.2e-23 PFAM
low complexity region 410 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145099
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Other mutations in Zc3h15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Zc3h15 APN 2 83660173 missense probably damaging 1.00
IGL01688:Zc3h15 APN 2 83662192 missense probably damaging 0.99
IGL01951:Zc3h15 APN 2 83661485 missense probably damaging 1.00
IGL02514:Zc3h15 APN 2 83653381 missense probably damaging 1.00
IGL02852:Zc3h15 APN 2 83644671 missense possibly damaging 0.85
IGL03075:Zc3h15 APN 2 83662191 missense possibly damaging 0.95
IGL03055:Zc3h15 UTSW 2 83661171 missense possibly damaging 0.90
R0117:Zc3h15 UTSW 2 83658083 missense possibly damaging 0.51
R0465:Zc3h15 UTSW 2 83663815 splice site probably benign
R1711:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R1861:Zc3h15 UTSW 2 83663990 missense unknown
R2258:Zc3h15 UTSW 2 83657016 missense probably benign 0.00
R2325:Zc3h15 UTSW 2 83653439 missense probably damaging 1.00
R4152:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4420:Zc3h15 UTSW 2 83658012 missense probably damaging 0.97
R5384:Zc3h15 UTSW 2 83660230 missense possibly damaging 0.55
R6341:Zc3h15 UTSW 2 83661223 missense probably benign 0.11
R6544:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R6923:Zc3h15 UTSW 2 83657056 missense possibly damaging 0.68
R7770:Zc3h15 UTSW 2 83658132 missense possibly damaging 0.49
R8782:Zc3h15 UTSW 2 83661443 missense probably benign 0.14
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-14